... TALEN plasmids targeting 48 sites in the EGFP reporter gene.... for EGFP Engineered TALENs for the EGFP Reporter Gene The Joung Lab recently used their high-throughput...engineered TALENs targeted to 48 sites in the EGFP reporter gene ( Reyon & Tsai et al., Nat Biotechnol. 2012...active at their target sites on an integrated EGFP reporter gene in cultured U2OS cells. EGFP TALEN Plasmid...

...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins Ratiometric...imaging (Perceval) A genetically encoded fluorescent reporter of ATP:ADP ratio. Nat Methods. 2009 Feb . 6(2)...

...Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids Tagging and Visualization Purification...expression at a specific level. Return to Top Reporter Plasmids Reporter plasmids can be used to detect events...they activate expression of the reporter gene. Plasmid ID Promoter Reporter PI Purpose pRU Series Various...Purification Controlled Expression Reporter Plasmids You may also like… Plasmids 101 Addgene's Molecular...promoters, their associated transcription factors, and reporter genes. pCS-PesaRlux 47640 PesaR 3OC6HSL (Quorum...bacterium. Plasmids containing easily measurable reporter genes (eg. LacZ or Fluorescent Proteins ) under...transcription factor to bind to a small molecule, the reporter plasmid can be used to detect the presence of ...

...Multiple Multi-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, ...Highlights Empty Backbones Expression Constructs Reporter Constructs Luciferase is the enzyme responsible... common choice in assays ranging from use as a reporter gene in vitro and in vivo to use in biosensors...-lives, making them useful as transcriptional reporters. However, they are not secreted, so cells must...CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle of the Firefly.... pKC-4.04, pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase...of enhancer activity using a Firefly luciferase reporter. These plasmids improve over the original STARR-seq...

...repression YFP reporter: protospacer B 48662 SK-YFP-ST1-B Bacterial ST1 repression YFP reporter: protospacer...repression YFP reporter: protospacer B 48664 SK-YFP-NM-A Bacterial NM repression YFP reporter: protospacer...repression YFP reporter: protospacer A 48666 SK-YFP-TD-A Bacterial TD repression YFP reporter: protospacer...48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer 48678...48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer ...48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer...

...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for... Lentiviral reporter vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing...pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing firefly luciferase and ZsGreen...ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter vector expressing mCherry and firefly luciferase...destabilized EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...

...sites AAV Uchida Cre Reporters and Tools In this subtype of loxP plasmids, reporter genes indicate which...Mammalian Pelczar 62732 Cre Reporter DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP...Vectors Cre-containing Plasmids loxP Constructs Cre Reporters & Tools Additional Resources References Background...Fluorescent Cre: The fusion of Cre to a fluorescent reporter enables visualization of Cre expression. Optimized...HRE:GFP-pGK:Cre Cre and hypoxia-responsive GFP reporter HRE Lentiviral Jacks 69570 pAAV-EF1a-N-CretrcintG...Alcudia 108639 fli1aCreERT2 Cre-ERT2; endothelial reporter fli1a Zebrafish Mercader Huber 108995 pDM1488 ...constructs Multibow uses a binary code in which reporters are initially OFF and then probabilistically ON...

...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV... also lists several luciferase and fluorescent reporter plasmids that have been used for measuring viral...on each item's material page. Actual titers are reported with each shipment. Ginkgo Bioworks Plasmid Collection...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...2020 May 14;181(4):865-876.e12. CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...

...iGlucoSnFr Norepinephrine (NE) Sensors GRAB_NE Voltage Reporters Archon Voltron JEDI-2P 5-HT Sensors GRAB_5-HT ... (control) none Constitutive 9, rg* Li Voltage Reporter: Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-...Syn Archon1 EGFP Cre dependent 8 Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn ...Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter: JEDI-2P 179459 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE ...

...on each item's material page. Actual titers are reported with each shipment. Find Available AAV Lentivirus...on each item's material page. Actual titers are reported with each shipment. Find Available Lentiviruses...Resources Addgene's Data Hub : Curated technical reports from the research community demonstrating AAV performance...

...with EF1alpha addition of mCherry reporter variant nuclear reporters via an H2B fusion shuttle plasmid...advantage of the Zhang lab all-in-one (guide/Cas9/reporter) pX458 plasmid family. They have made several ...

...induced reprogramming to pluripotency. Stem Cell Reports. 2015 Apr 14;4(4):727-43. Woltjen Plasmid Mouse...self-regulating and nonintegrating viral vectors. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. Jaenisch...Cells and B Lymphocytes to Neural Stem Cells. Cell Reports. 2014 Dec 11;9(5):1673-80. Parmar Fibroblasts Astrocytes...astrocytes by defined transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory...

...editing, empty backbones, fluorescent proteins, reporters, biosensors, and Cre expression plasmids. Large...studying diseases, are listed below: Lipid droplet reporters - Richard White Lab. An imaging platform to study...using red light. LipoGlo - Steven Farber Lab. A reporter system that allows direct assessment of lipoprotein...

...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler...transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452...

...filtered by receptor type, plasmid type, promoter, reporter or fusion protein, and whether the plasmid is ... Promoter Synapsin CaMKIIa CD68 Dlx GFAP Other Reporter/Fusion mCherry IRES-mCitrine tdTomato ChR2 IRES-EGFP...Available Clear Filters ID Plasmid Receptor Promoter Reporter/Fusion Cre-dependent? PI 50476 pAAV-CaMKIIa-hM3D...

...Selectable markers Viral expression and packaging Reporters, shRNA expression, transgenics and genome... AdEasy®-1 plasmid Back to Top Reporters, shRNA expression, transgenics and genome ...promoter strength pBV-Luc - Luciferase reporter plasmid with very low basal activity shRNA/RNAi...

... are true. Always express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian...RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP all...removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 No TCG, TCA, or TAG...

...on each item's material page. Actual titers are reported with each shipment. For more details about our...Biosensors Calcium Sensors Glutamate Sensors Voltage Reporters Controls Fluorescent Proteins Spagehetti Monster...

...Endogenous Zebrafish Gene Targets Recent published reports have shown that engineered zinc finger nucleases...greater in a well-characterized bacterial two-hybrid reporter system but have NOT yet been tested for activity...

...set of lentiviral transfer vectors you can find reporter plasmids to test whether or not you’ve efficiently...to generate adenovirus expressing a variety of reporters as well as the Cre and Flp recombinases. Genes...