We narrowed to 1,033 results for: CAT;

...cohesive team environment. Neglecting communication skillsClear communication is the backbone of effective management...management. Miscommunication often arises when managers fail to set expectations or provide timely feedback...firsthand when it took me some time to adapt to the communication style of a new, junior team member who had values...and leveraging tools like the Myers-Briggs Type Indicator or DISC assessments can help you navigate team...

...of the biosensors used in research are very sophisticated, but at their core they can all be boiled down...ready-to-use. While biosensors span the gamut of applications within chemistry, biology, and physics, in this...sensors can be targeted to different cellular locations or tissues depending on the biology you are studying...different factors, in different or the same cellular location, all at once! Small molecules What type of small...Neurotransmission and Neuromodulation: Engineering and Applications. Frontiers in Cellular Neuroscience. 2019 Oct...

... our knowledge. Disease Applications Q13: Does AAV have potential applications in diseases which may be...Did you catch our April AAV webinar with Tim Miles, PhD, Director of the CLOVER Center at CalTech? If...1x1014 vg/ml.. As evident in our repository, this application is an outlier for PHP.eB (1x1011 - 1x1012 vg/...CRISPR tools is an exciting area for future AAV application to epigenetic editing. This area is discussed...

...thus allowing repair to take place before DNA replication. Indeed, they observed that 41/42 embryos were... embryos carried indels at the mutation site, indicating that repair proceeded through NHEJ rather than...attributable to CRISPR editing. Conclusions & implications One striking feature of this paper is the failure... need to be much, much lower before clinical applications could be considered. It is important to consider...experiments are needed before we can consider clinical applications for germline editing. Although this paper represents...

...aggregates. This property can be tolerated in some applications (e.g. labeling of cells or tracking promotor...promotor activity), but it is problematic in applications in which the fluorescent protein is used as an inert...During the experiment, the solution is diluted, complicating the interpretation. Because of this, these methods...aware that the fluorescent proteins reported in publications are only characterized under a limited number...build a valuable resource with tools and data that indicate the performance of (a set of) fluorescent proteins...

...seizures, and other symptoms as discussed in this educational video. “SLC6A8 belongs to a large family of solute.... “This proof of concept study will help in identification of new targets that could greatly enhance our...professor and assistant dean of biomedical science education at McGill University.  These protein-receptor ...58 individuals with GNB1 disorder since the identification of this disease in 2016. The lab aims to “expand...pathways using biosensors as well. “The Addgene catalog would allow us to enhance our biosensor repository...

...of DNA that can potentially complicate results of a downstream application such as quantitative PCR to...easier. Recently, we published a blog on DNA purification without a kit that outlined several reasons ...take care whenever doing any type of DNA or RNA purification to avoid contamination, take extra care when..., that isn’t the case for RNA extraction and purification. There is one simple method that works, and ...

...experiments. Recombinant AAVs (rAAVs) The primary application of AAV is delivery of genetic cargo to a host...numerical designations, separated by a slash, that indicate the ITR and serotype, respectively. For example...transduced gene is episomal and does not divide and replicate in the same way the host DNA does. Because of ... since you don’t have to wait for the host to replicate the DNA before expression. Now that you’ve got... S., et al. “Various AAV Serotypes and Their Applications in Gene Therapy: An Overview.” Cells, 12(5),...

... these stromal cell modifications, stromal cells are also constantly communicating with a tumor, proving... was contributed by Bárbara Pinho, a science communicator at the Portuguese science museum "Fábrica Centro...Proficient in transportation, exosomes are tools of communication and provide malignancy to the microenvironment... Pinho! Bárbara Pinho is currently a science communicator at the Portuguese science museum "Fábrica Centro...

...methods for identifying PPIs, such as affinity purification mass spectrometry (AP-MS), lack the ability ...the validation of a binary PPI as well as the identification of additional interacting factors. Problems...detect weak and/or transient PPIs. Many PPI identification techniques rely on protein interactors to stay... AP-MS. This requirement often prevents the identification of weak and/or transient interacting proteins...spatiotemporally defined protein complexes. Nature communications. PubMed PMID: 28585547. PubMed Central PMCID...

...2021.   The potential tools fall into two categories: probes and editors. A probe array may consist...and should be varied as it can have important implications for the fusion protein effectivity), and a fluorescent...to visualize DNA, an editor targets DNA (via catalytically inactive dCas9) to modify chromatin. A fluorescent...both spatiotemporal protein degradation and quantification of this depletion using imaging-based measurements...BioTag, which can be used in protein affinity purification studies.    Duong et al., Genetics 2021. https...

...techniques that can be used to introduce genetic modifications into mouse embryos. But once you generate a ...techniques are each useful for introducing one modification into the mouse genome, they are not commonly...parental mice In order to ensure that your genetic modification will be passed along to all of the offspring...environment and will harbor similar epigenetic modifications. Special breeding cases Whether your mouse colony...the mutations that you are trying to cross are located on homologous chromosomes in the parental generation...

...stimuli. Cre recombinase catalyzes the recombination of DNA sequences located between two loxP sites. ...in research can fall under one of two broad classifications: inbred or outbred. Inbred strains share a ...Knockout mice Knockout mice have undergone genetic modification that alters or eliminates the expression of ...can be used to invert a segment of DNA or to translocate a piece of DNA from one region of the genome ...

...including RNPs for indel formation via NHEJ, precise modification with Homology Directed Repair (HDR), CRISPR ...potential to be used for other types of CRISPR applications. Let’s take a look at the key components of ... which means they are non-infectious and non-replicative. Nanoblades are produced by transfecting the ...incubating Nanoblade particles with polybrene, a cationic polymer. Polybrene has long been used to increase...with Cas9-sgRNA ribonucleoproteins." Nature communications 10.1 (2019): 45. PubMed PMID: 30604748. PubMed...

...experiment and they don't do anything. Viruses are complicated and they perform complex biological tasks, both...vector may undergo genomic rearrangements during replication. To avoid genomic rearrangements, try amplifying...membranes (Davis et al., 2002). Polybrene is one such cationic reagent that is commonly used and has been shown... during transfection, and does not necessarily indicate the production of virus. Alternatively, if the...hepatitis B virus DNA and hepatitis C virus RNA quantification as measured with branched-DNA technology." ...

...functionality can be gained by understanding the location and transport of the protein within a living cell...to observe membrane trafficking events in vivo. Locate your protein and see who it is hanging out with...potential overlap, it is possible to determine the location of proteins within complex structures. In order...way it is important to choose the appropriate quantification methods and tools. It is usually not enough...intracellular pathogens In addition to tracking the location of proteins it is also possible to follow the ...

... (green or blue) within a population of timer indicates the age of the pool: the higher the ratio, the...-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT -  Applications of fluorescent protein timers FP timers have...biological event (trafficking to a subcellular location, start of gene expression, development of a cell... insulin-secreting beta-like cells." Nature communications 7 (2016). PubMed PMID: 27063289. PubMed Central...Learn More About Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your...

...been excitedly testing NgAgo's genome editing applications. So, how does NgAgo stack up thus far? A few...survey. When asked if they could detect indels (an indication of gene disruption ability) with NgAgo, one respondent...could not achieve indels with the NgAgo system indicates that it is very tricky to use and fussy to optimize... S. Lander, and Feng Zhang. "Development and applications of CRISPR-Cas9 for genome engineering." Cell...Addgene.org Request NgAgo Find CRISPR Resources Catch Up on Your CRISPR Background ...

...? Patron: Sainsbury has a mandate to share and educate and enable plant science in general. We are funded...easier because individual labs will not need to ‘domesticate’ all the basic and necessary elements in order... you are in the lab. There is no PCR, no gel purification; the whole cloning process is so simplistic ...tweet about plant synthetic biology, science communication, women in science, and many other topics. What...well-rounded human beings. It’s also a great communication tool for work. Most Sainsbury scientists are...

...Initiative. Endy's team made news in March with a publication in Science describing the development of “transcriptors...work, and it begins with the central dogma - replication of DNA, transcription of DNA to make RNA, translation..., humans have two types of languages: one to communicate amongst each other, like this conversation we... in English, and then there are languages to communicate with other things. These are programming languages...successful in the long term, if it's going to communicate between humans (i.e., our dreams and intentions...

...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...

...develop diverse fluorescent reporters is a useful application of high-throughput cloning. MXS Chaining is one...plasmids for fluorescence imaging or flow cytometry applications in mammalian cells. The modules used in this...transgene expression, or a variety of other clever applications. In one example, modular constructs generated...methods are suited for particular downstream applications. The tradeoffs between various cloning methods...technique to engineer various constructs with applications in flow cytometry approaches in mammalian cell...

...my job. The same can be said about teamwork, communication, writing, management, and creativity; I have...have the desired degree, you have mastered the applications they use, you’ve gained experience working with...to solve a problem. When they ask about your communication style, your potential teammates want to be assured...ve had to flex your conflict management and communication skills quite a bit. Grab a piece of paper and...Negotiation Career Planning Resources Cross team communication  External collaborators For further advice ...

...performs well in many different antibody-based applications.  IPI’s recombinant version is a fusion of mouse...with additional cofactors or using significantly truncated forms that limit its functionality. To make biophysical...cellular processes in C. elegans: mScarlet3 for applications needing intense brightness (such as low-expression...luciferase fragment (expressed separately) assemble and catalyze the luminescence reaction (Figure 5). The researchers...under tension. Upon binding, LgBiT and BiT Tag catalyze a luminescent reaction with the substrate furimazine...

... their organismal systems for scientists and educational programs for K-12 students. You can see why I...parenting strategies and make important ecological indicators since species live in water and on land. Current...which have been used to treat heart disease. Caterpillars that eat milkweed generate cardenolides that... poisonous) for bird predators - birds eat a caterpillar once, vomit, and never do it again. Cichlids ... expensive. They are using a cool fluorescent indicator system to rapidly identify recombinants. Arthropods...

...Addgene recently moved to our brand new location, with more space to grow and help scientists share resources... resources in new ways. Along with a new location comes the need for new conference room names. The Addgenie...transposon system including those from the original publication, Ivics et al 1997. Spaghetti Squash, a regulator...bunch of cookie monster eyes.”  Check out the publication to see for yourself. We have one plasmid in our...Bodmer, Rolf. "The gene tinman is required for specification of the heart and visceral muscles in Drosophila...

...positioned like Cas12a PAM sites. For Cas9, the PAM is located just downstream (3′ end) of the target sequence...-strand breaks like those created by Cas12a. Applications of TnpB One of the major challenges in genome...5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 (specific to your target...viral vectors and for multiplexed gene editing applications. As research into TnpB continues to evolve, ...elaborate protocols are available in our earlier publications (Karmakar et al., 2024; Karmakar et al., 2025...

... proteins.Therefore, GFP is not suitable for applications that require anaerobic conditions. In experiments...an additional protein module that can report on location. This approach enables the study of proteins in...fusion with GFP allows for detection of genomic locations (Chen et al., 2013). GFP fluorescence overlaps...case when proteins undergo post-translational modification with fatty acyl chains. For instance, myristoylation...C-terminal consensus sequence (-CaaX). Both modifications are disrupted when GFP is fused to these sequences...

...how many copies you are looking for. Secondly, categorize your edit – is it any frameshift mutation? A ...enzyme screening for resistivity to digestion, indicating targeted edits.   Interested in this method...a manageable number of the higher probability locations. If you’re worried about off-target effects, you...Tao Chen, Jos Jonkers, Bas van Steensel. Easy quantification of template-directed CRISPR-Cas9 editing. (...and variant-aware in silico off-target site identification for CRISPR genome editing. (2019) Bioinformatics...

...that carried out the labor-intensive process of replicating your new plasmid: the Escherichia coli bacteria...conjugation. Genes listed on F´ are wild-type unless indicated otherwise fhuA (formerly tonA) ferric hydroxamate...vectors. Used by Addgene for pooled library amplification. F' mcrA Δ(mcrBC-hsdRMS-mrr) recA1 endA1 gyrA96...typically standard; just having the gene listed indicates it is non-functional. If a gene is deleted, it... Most Popular Plasmids 101 Posts: Origin of Replication The Promoter Region – Let's Go! Mammalian Vectors...

...vessel barriers. It is especially popular for applications targeting liver tissue. In addition, it has ...the blood-brain barrier, making it useful for applications targeting the CNS (Issa et al., 2023). Additionally...treatment, which can pose problems for gene therapy applications. Cross-reactivity of AAV serotypes varies by...enhances astrocyte-directed transduction. Nature Communications, 14(1), 3792. https://doi.org/10.1038/s41467.... A. (2023). Various AAV Serotypes and Their Applications in Gene Therapy: An Overview. Cells, 12(5), ...

...Universities from five different geographical locations in Spain were enrolled: the University of Valencia...2014/2015, took place on July 27th, 2015 at a dedicated international mentoring conference held at the... own part, mentors receive immense personal gratification as they witness their student’s progress and...like IMP build bridges and global networks. They catalyze the development of knowledge, experience, resources...Mentoring Foundation for the Advancemnet of Higher Education website Resources at Addgene Read Other Career...

...target proteins of interest for labeling, quantification, purification, chromatin immunoprecipitation and more...created the Monoclonal Antibody Research Institute dedicated to: 1) developing new ways of generating antibodies...Freedom: The Expansion of Data Sharing in Research Publications ...

... policy implementation, program management, communications, diplomacy and international relations, advocacy...they train and bring researchers to Congress to advocate for increased science funding and other issues...sets for a science policy career is science communication so an outsized way to prepare is to do lots ...Initiative.    Get practical experience in science communication by writing for the Journal of Science Policy...connect you with alumni before and during your application process so you can learn more! Figure ...

...Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System...

...that have been used during the purification procedure. Good indicators of DNA purity are the absorbance...nm should fall ~1.8 - 2 and give scientists an indication of purity versus protein contaminants. The 260...nm ratios should fall ~2 - 2.2, and provide an indication of purity versus chaotropic agents as guanidine...

...resources can now be found in one place: the Educational Resources page. So let’s get to it. Here’s the...Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins by Cary Valley,...protein size and shape, linker sequences, and fusion location, there are many choices to make. 2. Prime Editing...Resources at Addgene Browse the repository Find educational resources at Addgene Search for plasmids at Addgene...

... adenine base editor variants using a protein-truncation strategy with reduced RNA-recognition capabilities...engineered tRNA adenosine deaminase (TadA) to a catalytically impaired Streptococcus pyogenes Cas9. They called... toolkit named ORANGE (Open Resource for the Application of Neuronal Genome Editing) mediates targeted...(A-to-I) RNA editor called REPAIR by fusing catalytically inactivated RNA-targeting Cas13 (dCas13) with...

...Thousands of mutations have been implicated in cancer. Yet, the majority of them remain uncharacterized...Using data from The Cancer Genome Atlas (TCGA), a catalog of genetic mutations responsible for cancer from... of mutations they identified included gene amplifications and fusions, missense mutations, and indels...aberration drivers of pancreatic cancer." Nature communications 7 (2016): 10500. PubMed PMID: 26806015. PubMed...

..., and you should always check the associated publication for the specifics of your chosen plasmid. Types...conformational changes, translation, and protein translocation. Targeting your biosensor Before expressing ...Experiments Experiment  Detection Method Notes Quantification of a process Plate-based assays (plate reader...components of individual cells Separation/identification of fluorescently-labeled components Fluorescence-activated...

...Knowing where bacteria are located within their host is often key to understanding their role in both...reporters are not as well suited for imaging organs located deep in the body, like the gastrointestinal tract...lab recently discovered that gas vesicles also scatter sound waves and therefore produce signals in ultrasound... experiment to demonstrate the most exciting application for ARG’s: in vivo imaging. Specifically, arg1...

...genes are truly dispensable or are the current identification methods missing something? Here we will review...review some time-tested gene identification systems that may have a leg up on their modern counterparts...considerable distance away from a gene which can make identification of the gene itself difficult. The best trap...transposon, and many more! Check out Addgene’s catalog to find trapping tools for your next experiment...

...be used to generate organoid cultures with a modification of interest. While the authors optimized the...mechanisms related to morphogenesis, cell fate specification, and human disease.     Sun, et al. bioRxiv...protoplasts, the enzymatic biosensor retains its catalytic activity.  As SLs are also known to trigger seed...parasitization of cereal crops. As a result, agricultural applications of these novel biosensors could have a major...

...plasmids are categorized into a 3-level system on our website:   A yellow flame indicates that a plasmid...re proud to honor the creativity, passion, and dedication to sharing epitomized by the creators of these...Since we so sincerely appreciate our depositor’s dedication to scientific sharing, we wanted to celebrate...

...symposia on Sunday afternoon were dedicated to science communication through art. Addgene Advisory Board...Waterlilies one!). As we dive more into science education and outreach ourselves, we can a learn a lot from... resource sharing and was also a great place to catch up with former colleagues! I ran into past ASM President...

...sessions to help undergraduate students with their applications. The society currently has 1,283 members, who... society organizes numerous recreational and educational events throughout the year, including a Christmas...between biology and synthetic biology by providing education and networking opportunities for society members...and what benefits did they provide during your education? Let us know in the comments section below! Do...

...the gRNA design process and rules for various applications is necessary going forward. The standardization... I think I may have finally grasped just how complicated DNA repair pathways are. I fully admit to being...Alt-NHEJ), has been harnessed for CRISPR knock-in applications. CRISPR 101: Targeting RNA with Cas13a (C2c2...for CRISPR Genome Editing Other resources and publications CRISPOR gRNA design tool Researchers at the ...

...markers for plant transformation fall into two main categories: antibiotic/herbicide resistance and fluorescent...culture), which is great for a wide variety of applications. But some techniques require you to select against...these mutant plants. Using RUBY to simplify the identification of these mutants will speed up my work and ...student studying plant development and cell-cell communication in the Nimchuk Lab in the Biology Department...

...kinetics) that makes them suitable for different applications. We recently released a new variant of jGCaMP7... been developed and are suited for different applications. The iGABASnFR GABA sensor (pAAV.hSyn-FLEX.iGABASnFR...availability date or to be notified when a particular catalog item is available for order please email [email protected] coming in our new 20 ul trial size! Voltage indicators Plasmid Serotype Name 119036  AAV1  pAAV-hsyn-flex-Voltron-ST...

...under harsh conditions. One example application from the publication is the removal of unwanted cDNA derived...the van der Oost lab. Phylogenetic comparison indicates that like GeoCas9 and ThermoCas9, IgnaviCas9 is...a thermostable Cas9 be useful? It can enable applications where reagents must be stored at elevated temperatures...