We narrowed to 1,023 results for: CAT;
-
TypeBlog Post...of the biosensors used in research are very sophisticated, but at their core they can all be boiled down...ready-to-use. While biosensors span the gamut of applications within chemistry, biology, and physics, in this...sensors can be targeted to different cellular locations or tissues depending on the biology you are studying...different factors, in different or the same cellular location, all at once! Small molecules What type of small...Neurotransmission and Neuromodulation: Engineering and Applications. Frontiers in Cellular Neuroscience. 2019 Oct...
-
Luminescent Imaging with Nano-lanterns
TypeBlog Post...resulting in a fluorescent signal. Since their first publication in 2012, the Nagai laboratory has assembled a...multicolored nano-lanterns for use in various applications, including optogenetics, biosensors, and fusion...sensitivity and faster imaging compared to previous publications. They also developed calcium, cAMP, and ATP ...furimazine. In addition to the previously described applications, the enhanced signal of eNL allows their use...characterizing Nano-lanterns and eNL for many different applications. For long-term imaging, especially where photobleaching... -
Supporting Rare Disease Research with the 2020 BeHEARD Awards
TypeBlog Post...seizures, and other symptoms as discussed in this educational video. “SLC6A8 belongs to a large family of solute.... “This proof of concept study will help in identification of new targets that could greatly enhance our...professor and assistant dean of biomedical science education at McGill University. These protein-receptor ...58 individuals with GNB1 disorder since the identification of this disease in 2016. The lab aims to “expand...pathways using biosensors as well. “The Addgene catalog would allow us to enhance our biosensor repository... -
RNA Extraction Without A Kit
TypeBlog Post...of DNA that can potentially complicate results of a downstream application such as quantitative PCR to...easier. Recently, we published a blog on DNA purification without a kit that outlined several reasons ...take care whenever doing any type of DNA or RNA purification to avoid contamination, take extra care when..., that isn’t the case for RNA extraction and purification. There is one simple method that works, and ... -
The Breast Cancer Microenvironment: A Tumor’s Backstage Team
TypeBlog Post... these stromal cell modifications, stromal cells are also constantly communicating with a tumor, proving... was contributed by Bárbara Pinho, a science communicator at the Portuguese science museum "Fábrica Centro...Proficient in transportation, exosomes are tools of communication and provide malignancy to the microenvironment... Pinho! Bárbara Pinho is currently a science communicator at the Portuguese science museum "Fábrica Centro... -
Viral Vectors 101: An Introduction to AAV
TypeBlog Post...experiments. Recombinant AAVs (rAAVs) The primary application of AAV is delivery of genetic cargo to a host...numerical designations, separated by a slash, that indicate the ITR and serotype, respectively. For example...transduced gene is episomal and does not divide and replicate in the same way the host DNA does. Because of ... since you don’t have to wait for the host to replicate the DNA before expression. Now that you’ve got... S., et al. “Various AAV Serotypes and Their Applications in Gene Therapy: An Overview.” Cells, 12(5),... -
Human Germline Editing Using CRISPR
TypeBlog Post...thus allowing repair to take place before DNA replication. Indeed, they observed that 41/42 embryos were... embryos carried indels at the mutation site, indicating that repair proceeded through NHEJ rather than...attributable to CRISPR editing. Conclusions & implications One striking feature of this paper is the failure... need to be much, much lower before clinical applications could be considered. It is important to consider...experiments are needed before we can consider clinical applications for germline editing. Although this paper represents... -
Choosing the B(right)est Fluorescent Protein: Aggregation Tendency
TypeBlog Post...aggregates. This property can be tolerated in some applications (e.g. labeling of cells or tracking promotor...promotor activity), but it is problematic in applications in which the fluorescent protein is used as an inert...During the experiment, the solution is diluted, complicating the interpretation. Because of this, these methods...aware that the fluorescent proteins reported in publications are only characterized under a limited number...build a valuable resource with tools and data that indicate the performance of (a set of) fluorescent proteins... -
Hot Plasmids and Viral Preps - March 2021
TypeBlog Post...2021. The potential tools fall into two categories: probes and editors. A probe array may consist...and should be varied as it can have important implications for the fusion protein effectivity), and a fluorescent...to visualize DNA, an editor targets DNA (via catalytically inactive dCas9) to modify chromatin. A fluorescent...both spatiotemporal protein degradation and quantification of this depletion using imaging-based measurements...BioTag, which can be used in protein affinity purification studies. Duong et al., Genetics 2021. https... -
Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells
TypeBlog Post...including RNPs for indel formation via NHEJ, precise modification with Homology Directed Repair (HDR), CRISPR ...potential to be used for other types of CRISPR applications. Let’s take a look at the key components of ... which means they are non-infectious and non-replicative. Nanoblades are produced by transfecting the ...incubating Nanoblade particles with polybrene, a cationic polymer. Polybrene has long been used to increase...with Cas9-sgRNA ribonucleoproteins." Nature communications 10.1 (2019): 45. PubMed PMID: 30604748. PubMed... -
Mouse Modeling, Part 2: Breeding and Crossing Mice
TypeBlog Post...techniques that can be used to introduce genetic modifications into mouse embryos. But once you generate a ...techniques are each useful for introducing one modification into the mouse genome, they are not commonly...parental mice In order to ensure that your genetic modification will be passed along to all of the offspring...environment and will harbor similar epigenetic modifications. Special breeding cases Whether your mouse colony...the mutations that you are trying to cross are located on homologous chromosomes in the parental generation... -
Mouse Modeling, Part 1: Genetically Engineered Mice
TypeBlog Post...stimuli. Cre recombinase catalyzes the recombination of DNA sequences located between two loxP sites. ...in research can fall under one of two broad classifications: inbred or outbred. Inbred strains share a ...Knockout mice Knockout mice have undergone genetic modification that alters or eliminates the expression of ...can be used to invert a segment of DNA or to translocate a piece of DNA from one region of the genome ... -
Split-BioID: An Improved Method for Studying Protein-Protein Interactions
TypeBlog Post...methods for identifying PPIs, such as affinity purification mass spectrometry (AP-MS), lack the ability ...the validation of a binary PPI as well as the identification of additional interacting factors. Problems...detect weak and/or transient PPIs. Many PPI identification techniques rely on protein interactors to stay... AP-MS. This requirement often prevents the identification of weak and/or transient interacting proteins...spatiotemporally defined protein complexes. Nature communications. PubMed PMID: 28585547. PubMed Central PMCID... -
5 Tips for Troubleshooting Viral Transductions
TypeBlog Post...experiment and they don't do anything. Viruses are complicated and they perform complex biological tasks, both...vector may undergo genomic rearrangements during replication. To avoid genomic rearrangements, try amplifying...membranes (Davis et al., 2002). Polybrene is one such cationic reagent that is commonly used and has been shown... during transfection, and does not necessarily indicate the production of virus. Alternatively, if the...hepatitis B virus DNA and hepatitis C virus RNA quantification as measured with branched-DNA technology." ... -
Fluorescent Proteins 101: Visualizing Subcellular Structures & Organelles
TypeBlog Post...functionality can be gained by understanding the location and transport of the protein within a living cell...to observe membrane trafficking events in vivo. Locate your protein and see who it is hanging out with...potential overlap, it is possible to determine the location of proteins within complex structures. In order...way it is important to choose the appropriate quantification methods and tools. It is usually not enough...intracellular pathogens In addition to tracking the location of proteins it is also possible to follow the ... -
Fluorescent Proteins 101: Fluorescent Protein Timers
TypeBlog Post... (green or blue) within a population of timer indicates the age of the pool: the higher the ratio, the...-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT - Applications of fluorescent protein timers FP timers have...biological event (trafficking to a subcellular location, start of gene expression, development of a cell... insulin-secreting beta-like cells." Nature communications 7 (2016). PubMed PMID: 27063289. PubMed Central...Learn More About Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your... -
Google Forums Round Up: First Impressions of NgAgo
TypeBlog Post...been excitedly testing NgAgo's genome editing applications. So, how does NgAgo stack up thus far? A few...survey. When asked if they could detect indels (an indication of gene disruption ability) with NgAgo, one respondent...could not achieve indels with the NgAgo system indicates that it is very tricky to use and fussy to optimize... S. Lander, and Feng Zhang. "Development and applications of CRISPR-Cas9 for genome engineering." Cell...Addgene.org Request NgAgo Find CRISPR Resources Catch Up on Your CRISPR Background ... -
Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More
TypeBlog Post...? Patron: Sainsbury has a mandate to share and educate and enable plant science in general. We are funded...easier because individual labs will not need to ‘domesticate’ all the basic and necessary elements in order... you are in the lab. There is no PCR, no gel purification; the whole cloning process is so simplistic ...tweet about plant synthetic biology, science communication, women in science, and many other topics. What...well-rounded human beings. It’s also a great communication tool for work. Most Sainsbury scientists are... -
Drew Endy Introduces the Biobrick Public Agreement Plasmid Collection
TypeBlog Post...Initiative. Endy's team made news in March with a publication in Science describing the development of “transcriptors...work, and it begins with the central dogma - replication of DNA, transcription of DNA to make RNA, translation..., humans have two types of languages: one to communicate amongst each other, like this conversation we... in English, and then there are languages to communicate with other things. These are programming languages...successful in the long term, if it's going to communicate between humans (i.e., our dreams and intentions... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:... -
MXS Chaining
TypeBlog Post...develop diverse fluorescent reporters is a useful application of high-throughput cloning. MXS Chaining is one...plasmids for fluorescence imaging or flow cytometry applications in mammalian cells. The modules used in this...transgene expression, or a variety of other clever applications. In one example, modular constructs generated...methods are suited for particular downstream applications. The tradeoffs between various cloning methods...technique to engineer various constructs with applications in flow cytometry approaches in mammalian cell... -
Transferable Skills Guide: Identifying Your Transferable Skills
TypeBlog Post...my job. The same can be said about teamwork, communication, writing, management, and creativity; I have...have the desired degree, you have mastered the applications they use, you’ve gained experience working with...to solve a problem. When they ask about your communication style, your potential teammates want to be assured...ve had to flex your conflict management and communication skills quite a bit. Grab a piece of paper and...Negotiation Career Planning Resources Cross team communication External collaborators For further advice ... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post... their organismal systems for scientists and educational programs for K-12 students. You can see why I...parenting strategies and make important ecological indicators since species live in water and on land. Current...which have been used to treat heart disease. Caterpillars that eat milkweed generate cardenolides that... poisonous) for bird predators - birds eat a caterpillar once, vomit, and never do it again. Cichlids ... expensive. They are using a cool fluorescent indicator system to rapidly identify recombinants. Arthropods... -
Sonic Hedgehog? Sleeping Beauty? Learn About the Genes Behind Addgene’s Conference Room Names
TypeBlog Post...Addgene recently moved to our brand new location, with more space to grow and help scientists share resources... resources in new ways. Along with a new location comes the need for new conference room names. The Addgenie...transposon system including those from the original publication, Ivics et al 1997. Spaghetti Squash, a regulator...bunch of cookie monster eyes.” Check out the publication to see for yourself. We have one plasmid in our...Bodmer, Rolf. "The gene tinman is required for specification of the heart and visceral muscles in Drosophila... -
Hot Plasmids: Fall 2024
TypeBlog Post...performs well in many different antibody-based applications. IPI’s recombinant version is a fusion of mouse...with additional cofactors or using significantly truncated forms that limit its functionality. To make biophysical...cellular processes in C. elegans: mScarlet3 for applications needing intense brightness (such as low-expression...luciferase fragment (expressed separately) assemble and catalyze the luminescence reaction (Figure 5). The researchers...under tension. Upon binding, LgBiT and BiT Tag catalyze a luminescent reaction with the substrate furimazine... -
Fluorescent Proteins 101: When GFP lets you down
TypeBlog Post... proteins.Therefore, GFP is not suitable for applications that require anaerobic conditions. In experiments...an additional protein module that can report on location. This approach enables the study of proteins in...fusion with GFP allows for detection of genomic locations (Chen et al., 2013). GFP fluorescence overlaps...case when proteins undergo post-translational modification with fatty acyl chains. For instance, myristoylation...C-terminal consensus sequence (-CaaX). Both modifications are disrupted when GFP is fused to these sequences... -
CRISPR 101: Validating Your Genome Edit
TypeBlog Post...how many copies you are looking for. Secondly, categorize your edit – is it any frameshift mutation? A ...enzyme screening for resistivity to digestion, indicating targeted edits. Interested in this method...a manageable number of the higher probability locations. If you’re worried about off-target effects, you...Tao Chen, Jos Jonkers, Bas van Steensel. Easy quantification of template-directed CRISPR-Cas9 editing. (...and variant-aware in silico off-target site identification for CRISPR genome editing. (2019) Bioinformatics... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...that carried out the labor-intensive process of replicating your new plasmid: the Escherichia coli bacteria...conjugation. Genes listed on F´ are wild-type unless indicated otherwise fhuA (formerly tonA) ferric hydroxamate...vectors. Used by Addgene for pooled library amplification. F' mcrA Δ(mcrBC-hsdRMS-mrr) recA1 endA1 gyrA96...typically standard; just having the gene listed indicates it is non-functional. If a gene is deleted, it... Most Popular Plasmids 101 Posts: Origin of Replication The Promoter Region – Let's Go! Mammalian Vectors... -
Building Global Connections with the International Mentorship Program USA-EUROPE
TypeBlog Post...Universities from five different geographical locations in Spain were enrolled: the University of Valencia...2014/2015, took place on July 27th, 2015 at a dedicated international mentoring conference held at the... own part, mentors receive immense personal gratification as they witness their student’s progress and...like IMP build bridges and global networks. They catalyze the development of knowledge, experience, resources...Mentoring Foundation for the Advancemnet of Higher Education website Resources at Addgene Read Other Career... -
The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing
TypeBlog Post...target proteins of interest for labeling, quantification, purification, chromatin immunoprecipitation and more...created the Monoclonal Antibody Research Institute dedicated to: 1) developing new ways of generating antibodies...Freedom: The Expansion of Data Sharing in Research Publications ... -
Finding Your Science Policy Path
TypeBlog Post... policy implementation, program management, communications, diplomacy and international relations, advocacy...they train and bring researchers to Congress to advocate for increased science funding and other issues...sets for a science policy career is science communication so an outsized way to prepare is to do lots ...Initiative. Get practical experience in science communication by writing for the Journal of Science Policy...connect you with alumni before and during your application process so you can learn more! Figure ... -
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency
TypeBlog Post...Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System... -
Plasmid Preps: Different Purity, Different Quantities, Different Uses
TypeBlog Post...that have been used during the purification procedure. Good indicators of DNA purity are the absorbance...nm should fall ~1.8 - 2 and give scientists an indication of purity versus protein contaminants. The 260...nm ratios should fall ~2 - 2.2, and provide an indication of purity versus chaotropic agents as guanidine... -
Our Most Popular Blog Posts from 2019
TypeBlog Post...resources can now be found in one place: the Educational Resources page. So let’s get to it. Here’s the...Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins by Cary Valley,...protein size and shape, linker sequences, and fusion location, there are many choices to make. 2. Prime Editing...Resources at Addgene Browse the repository Find educational resources at Addgene Search for plasmids at Addgene... -
What's New in CRISPR - December 2019
TypeBlog Post... adenine base editor variants using a protein-truncation strategy with reduced RNA-recognition capabilities...engineered tRNA adenosine deaminase (TadA) to a catalytically impaired Streptococcus pyogenes Cas9. They called... toolkit named ORANGE (Open Resource for the Application of Neuronal Genome Editing) mediates targeted...(A-to-I) RNA editor called REPAIR by fusing catalytically inactivated RNA-targeting Cas13 (dCas13) with... -
A new platform for fast functional characterization of potentially cancerous mutations
TypeBlog Post...Thousands of mutations have been implicated in cancer. Yet, the majority of them remain uncharacterized...Using data from The Cancer Genome Atlas (TCGA), a catalog of genetic mutations responsible for cancer from... of mutations they identified included gene amplifications and fusions, missense mutations, and indels...aberration drivers of pancreatic cancer." Nature communications 7 (2016): 10500. PubMed PMID: 26806015. PubMed... -
Hot Plasmids and Viral Preps - July 2021
TypeBlog Post...be used to generate organoid cultures with a modification of interest. While the authors optimized the...mechanisms related to morphogenesis, cell fate specification, and human disease. Sun, et al. bioRxiv...protoplasts, the enzymatic biosensor retains its catalytic activity. As SLs are also known to trigger seed...parasitization of cereal crops. As a result, agricultural applications of these novel biosensors could have a major... -
Using Ultrasound to Image Bacteria in vivo: Acoustic Reporter Genes
TypeBlog Post...Knowing where bacteria are located within their host is often key to understanding their role in both...reporters are not as well suited for imaging organs located deep in the body, like the gastrointestinal tract...lab recently discovered that gas vesicles also scatter sound waves and therefore produce signals in ultrasound... experiment to demonstrate the most exciting application for ARG’s: in vivo imaging. Specifically, arg1... -
Plasmids 101: Gene, enhancer, and promoter trapping
TypeBlog Post...genes are truly dispensable or are the current identification methods missing something? Here we will review...review some time-tested gene identification systems that may have a leg up on their modern counterparts...considerable distance away from a gene which can make identification of the gene itself difficult. The best trap...transposon, and many more! Check out Addgene’s catalog to find trapping tools for your next experiment... -
Fluorescent Proteins 101: Fluorescent Biosensors
TypeBlog Post..., and you should always check the associated publication for the specifics of your chosen plasmid. Types...conformational changes, translation, and protein translocation. Targeting your biosensor Before expressing ...Experiments Experiment Detection Method Notes Quantification of a process Plate-based assays (plate reader...components of individual cells Separation/identification of fluorescently-labeled components Fluorescence-activated... -
The Blue Flame Award: Celebrating Addgene's Most Requested Depositors
TypeBlog Post...plasmids are categorized into a 3-level system on our website: A yellow flame indicates that a plasmid...re proud to honor the creativity, passion, and dedication to sharing epitomized by the creators of these...Since we so sincerely appreciate our depositor’s dedication to scientific sharing, we wanted to celebrate... -
Addgene at the ASM Microbe 2016 Conference
TypeBlog Post...symposia on Sunday afternoon were dedicated to science communication through art. Addgene Advisory Board...Waterlilies one!). As we dive more into science education and outreach ourselves, we can a learn a lot from... resource sharing and was also a great place to catch up with former colleagues! I ran into past ASM President... -
Networking and Inspiring Young Scientists at Freshers Fairs
TypeBlog Post...sessions to help undergraduate students with their applications. The society currently has 1,283 members, who... society organizes numerous recreational and educational events throughout the year, including a Christmas...between biology and synthetic biology by providing education and networking opportunities for society members...and what benefits did they provide during your education? Let us know in the comments section below! Do... -
RUBY-Red Siliques
TypeBlog Post...markers for plant transformation fall into two main categories: antibiotic/herbicide resistance and fluorescent...culture), which is great for a wide variety of applications. But some techniques require you to select against...these mutant plants. Using RUBY to simplify the identification of these mutants will speed up my work and ...student studying plant development and cell-cell communication in the Nimchuk Lab in the Biology Department... -
New and Upcoming Viral Vectors - Spring 2019
TypeBlog Post...kinetics) that makes them suitable for different applications. We recently released a new variant of jGCaMP7... been developed and are suited for different applications. The iGABASnFR GABA sensor (pAAV.hSyn-FLEX.iGABASnFR...availability date or to be notified when a particular catalog item is available for order please email [email protected] coming in our new 20 ul trial size! Voltage indicators Plasmid Serotype Name 119036 AAV1 pAAV-hsyn-flex-Voltron-ST... -
CRISPR Challenges: Standardization and Homology Directed Repair
TypeBlog Post...the gRNA design process and rules for various applications is necessary going forward. The standardization... I think I may have finally grasped just how complicated DNA repair pathways are. I fully admit to being...Alt-NHEJ), has been harnessed for CRISPR knock-in applications. CRISPR 101: Targeting RNA with Cas13a (C2c2...for CRISPR Genome Editing Other resources and publications CRISPOR gRNA design tool Researchers at the ... -
Behind-the-scenes of the Isolation of the Thermostable IgnaviCas9 From a Yellowstone Hot Spring
TypeBlog Post...under harsh conditions. One example application from the publication is the removal of unwanted cDNA derived...the van der Oost lab. Phylogenetic comparison indicates that like GeoCas9 and ThermoCas9, IgnaviCas9 is...a thermostable Cas9 be useful? It can enable applications where reagents must be stored at elevated temperatures... -
Addgene's Top 10 Blog Posts of 2015
TypeBlog Post...overjoyed to provide you with these fantastic educational resources and will be sure to keep our eyes open...used to generate inversions, deletions, and translocations. It also provides researchers with many different...repository use Cas9 to cut DNA, Addgene Science Communications Intern Mary Gearing explains how Cas9 homolog...make it easier to make gene edits at new genomic locations. 6. CRISPR 101: Non-homologous End Joining So ... -
25 Work From Home Tips for Scientists
TypeBlog Post...for all ages. Organize your data and prepare publications or your dissertation Organize data that you...these drafts and for a few model organisms, Micropublication will accept negative data or publish brief...brief, novel findings. Most Micropublications contain one figure. If you aren’t there yet, write introductions...introductions to potential publications or prepare a review article. These are both options that can be done... -
DAP arrays for multiplex gene editing
TypeBlog Post...packaged into viral vectors for potential in vivo applications or multiplex CRISPR screening. Using tRNAs...multiplex genome engineering of crops or allow for sophisticated CRISPR screenings that would perturb the unprecedented...and efficient in plasmid and viral vectors. In applications when repetitive tRNA sequences must be avoided...construct DAP array for multiplex gene editing applications, we provide detailed manual and online design...