...TCTAATTGGTCTGTACCTaaagtggccgctaaggAAGCCCCCTGGGCTGATA lycat TAL3482 & TAL3483 TCCTTCATCTTCATCCAGcggcgctgggaggacgACCGCACACACATGAGCA lyl1 TAL3110...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...TAL3017 TGTTTCTGGCGGACTCTCgtcaccattcttctgtTTGAAGGCACACCTTTGA ahcyl1 TAL3018 & TAL3019 TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA...Aminopeptidase-o TAL3020 & TAL3021 TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA... arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA apoa4 TAL3022 & TAL3025 ...TAL3025 TGGCAGGACCAACCAATGcccagcatggacctggTGAAAAATGCTTTCTGGA apoa4-like TAL3023 & TAL3024 TGAAGGTTCTTGTGGTGCtcacacttgctgtggtTACAGGTAAGAAACTAAA...arap3a TAL3026 & TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA ARSA TAL 3002 & TAL 3003...

...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...

...encoded sensor and small molecule indicator: implications for quantification of cytosolic Zn(2+). ACS Chem... few popular categories of biosensors or browse all the biosensors tagged in our catalog . Use the article...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal...

... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the...

...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science...

...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Selectable Marker PI Publication Epigenetics To make targeted epigenetic modifications, researchers have ...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates... Gene/Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9) fused to a...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...

...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN... OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt NFATc1 OZ543 and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc Swachmann-Bodian-Diamond...gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN...

...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s clear...just as useful (if not more so) for research applications, eclipsing past genome engineering technologies...number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared...for CRISPR genomic editing. Genome Engineering Applications In 2012, Jinek et al. first demonstrated that... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool...

...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional... Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...population. ID Plasmid Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome Editing...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...gRNA Design Tools CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...

...advantage of using AAV for research is that it is replication-limited and typically not known to cause disease...certain exogenous gene products that mediate AAV replication. This requirement has been circumvented with ...expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Gradinaru 103006 pUCmini-iCAP-PHP.S PHP.S...expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Gradinaru 127847 pUCmini-iCAP-PHP.V1 ...expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10...expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Gradinaru 175005 pUCmini-iCAP-AAV.CAP-B22...expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Gradinaru 185136 pUCmini-iCAP-AAV.MaCPNS1...

...Catalytically inactive CRISPR plasmids for purification of target loci....conventional methods for genomic purification, CRISPR-based purification methods are more straightforward and...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...chromatin immunoprecipitation (ChIP) to allow purification of any genomic sequence specified by a particular...DNA-binding molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA... can be fused to dCas9 or gRNA for efficient purification. Various epitope tags including 3xFLAG-tag, ...

...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...gRNA complex, which is delivered to cells using cationic lipids Transient expression of CRISPR components...gene you target will depend on your specific application. For example: To activate or repress a target... that the target sequence be very close to the location of the desired edit, ideally less than 10 bp away...

... CAMP cathelicidin antimicrobial peptide CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37 CAT catalase MGC138422...hCD40L CD70 CD70 molecule CD27L, CD27LG, TNFSF7 CECR1 cat eye syndrome chromosome region, candidate 1 ADGF,...CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037,...phosphoinositide-3-kinase, catalytic, delta polypeptide p110D PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide...and adaptive immune signaling and cell-cell communication. Plasmid...

...Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...

...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish...Marker PI Publication Xenopus ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Parasites...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

...Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...

... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495....

...contribute to this publication. Citation information for openly shared communication: Adeno-Associated ...Addgene's 2018 AAV Education and Development (AAVED) workshop series. The... The AAV Education and Development ...Details Date: Friday September 21, 2018, 9 AM - 5 PM Location: Addgene, 75 Sidney St, Cambridge, MA, 02139 Organizing...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...antibodies and recommended dilutions, etc.), novel applications, or any other useful information. Experimental...

...Genome Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter...Reporter Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may...Bacteria? E. coli are commonly used to store and replicate plasmids of all types, but beyond that, researchers...sites within this plasmid. Return to Top Protein Purification Sometimes looking at a protein inside cells ...and, epitope tags can be used to simplify the purification process. Using plasmids in this collection, ...those tags from the purified protein. Protein purification can be challenging, but once you get it right... 5% sucrose. Other empty vectors for protein purification from the Structural Genomics Consortium and ...

...make targeted epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic ...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...enhancer for your gene of interest. Available modifications include: histone acetylation by p300 histone...or MQ1 cytosine demethylation by Tet1 These modifications persist over time and are potentially heritable...tables below for CRISPR plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID ...