We narrowed to 730 results for: SON

... yet retroviruses are RNA-containing viruses  (Robinson et al., 1965)! You may be beginning to realize...Brian O'Neill, with thanks to Addgenie Rebecca Hutcheson for her assistance with lentiviral replication...PMID: 26225354. PubMed Central PMCID: PMC4515362 Robinson, W. S., Pitkanen, A., & Rubin, H. (1965). The ... PMCID: PMC355630 Faras, A. J., Taylor, J. M., Levinson, W. E., Goodman, H. M., & Bishop, J. M. (1973)...

...maximise the time you are enjoying both work and personal life. There are no easy answers to negotiating...my colleagues and me. To that end, here are my personal 10 commandments for making it all work – most ...the “jobs” that take you away from having your personal time. Someone else can clean your house, pick ...you can’t make it to dinner this week. One swim lesson missed can mean a world of mental relaxation. And...

...biologist some time… months, in fact. In the Lee-Parsons lab, we are investigating how the production of...protein of interest. Find all plasmids from the Lee-Parsons lab. Test different leaf infiltration methods ...(Germany), before starting his work in the Lee-Parsons Lab.     References D'Aoust, Marc-André, et al.... De Ruijter, N. C. A., et al. "Evaluation and comparison of the GUS, LUC and GFP reporter system for gene...

...10.1038/nature09523  Ibraheim R, Song C-Q, Mir A, Amrani N, Xue W, Sontheimer EJ (2018) All-in-one adeno-associated...can be turned off by anti-CRISPR proteins. The Sontheimer lab used NmeCas9 with AAV to edit two different...0  Kim E, Koo T, Park SW, Kim D, Kim K, Cho H-Y, Song DW, Lee KJ, Jung MH, Kim S, Kim JH, Kim JH, Kim ...

...fluorescent biosensors. Aptabeacons Fluorescence resonance energy transfer (FRET) technology has been studied... sensitive detection assay. In 1999, Grate and Wilson paired laser cleavage and an RNA aptamer that bound... May 15;26(9):3725-36. PubMed PMID: 21419619. 9. Song, Kyung-Mi, et al. “Aptamers and Their Biological... 22368488. PubMed Central PMCID: PMC3279232. 10. Song, Shiping, et al. “Aptamer-based biosensors.” TrAC...

...restraining further replication.   Figure 3: Comparison of replication regulation mechanisms of stringently...regulation! This post was originally written by Jason Niehaus in December 2015 and was updated by Emily...464.1998 Grimwade, J. E., Rozgaja, T. A., Gupta, R., Dyson, K., Rao, P., & Leonard, A. C. (2018). Origin recognition.../doi.org/10.1093/nar/gky457 Park, K., Han, E., Paulsson, J., & Chattoraj, D. K. (2001). Origin pairing...

...relevant to you. Elect a devil’s advocate. This is the person whose job it is to disagree with the group. They...sure we have all experienced a meeting where one person speaks up after a group consensus and is immediately...entire company. It is important to note that the person who submitted the idea did not have to be in charge...always done it this other way,” you probably have reason to continue advocating for your idea. Our product...

...host tropism of your virus, there are many other reasons when you might pseudotype your virus:  Lowering...a cell surface to endocytose into the cell. The reason VSV-G is so commonly used is that it is good at...Sandoval, 2017). This high titer is one of the reasons VSV-G is used to transduce stem cells and neurons...https://doi.org/10.1093/hmg/10.19.2109 Sandrin V, Boson B, Salmon P, Gay W, Nègre D, Le Grand R, Trono ...

...believe GMOs are safe for human consumption in comparison to 37% of the general public (5, 6). Similarly... the public (8–13). Facing the possibility that reason is losing ground in public discourse, many scientists...politicians to interpret it for them. Other popular reasons to march include: General inclusion of science...policy should have more weight than how any one person feels about it. And yet research shows that thoughts...

...progeny are produced (Figure 1).  Figure 1: Comparison of the life cycle of a lentiviral vector with...integrase-deficient lentiviral vectors? There are several reasons why you might choose an IDLV over a lentiviral ...This blog post was written by Addgenie Rebecca Hutcheson.   References and resources References Banasik...PMC2835240 Wu Y. (2004). HIV-1 gene expression: lessons from provirus and non-integrated DNA. Retrovirology...

... make the best case for your candidacy. A major reason that a lot of candidates either get no interviews...understand your cover letter and research statement. My personal litmus test was whether my wife could explain ... please introduce yourself to me by email or in person. If you feel compelled to repay me in some way,...job searches. If you feel the urge to repay me personally, I will gratefully accept a very hoppy pint of...

...fellow at the Morgridge Institute for Research in Madison, Wisconsin. It is commonly cited that approximately...enzyme function, protein interaction, etc. by comparison to non-phosphorylated or ‘wild type’ control ...dephosphorylation reaction can be tracked through the comparison of phospho:non-phospho species on PhosTag gels...fellow at the Morgridge Institute for Research in Madison, Wisconsin. She is particularly interested in the...

...nuclear- or DNA-binding proteins, you may need to sonicate your lysates in order to release the proteins ...you’re using chemical blockers, you can run a comparison of different formulations instead of concentrations...temperature, and/or buffer to increase lysis Add sonication step to protein lysis Splice variants Check...lysing buffer/adjust lysing buffer strength Sonication based lysing protocol Subcellular fractional...  Rachel Leeson...

...Addgene. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA...publication at Addgene. Maeder ML, Angstman JF, Richardson ME, Linder SJ, Cascio VM, Tsai SQ, Ho QH, Sander...Sander JD, Reyon D, Bernstein BE, Costello JF, Wilkinson MF, Joung JK (2013) Targeted DNA demethylation... this publication at Addgene. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein...

... work, funding for science, and numerous other reasons. It is important to remember that we, scientists...Albany, NY, USA 42.6526°N 73.7562°W – Nicholas Thompson Over the last few years, there's been a disturbing...positive event that I hope happens again. Nicholas Thompson is a PhD Candidate studying Nuclear Science and...enforcement, and, although there was at least one person vocally protesting us, he was not threatening in...

...Many thanks to our guest blogger, Doug Richardson! Doug Richardson is the Director of the Harvard Center...This post was contributed by Doug Richardson, Director of the Harvard Center for Biological Imaging and... 2, 932-940 (2005). PubMed PMID: 16299478. 9. Richardson DS, Lichtman JW. Clarifying Tissue Clearing. ...

...Single-chain variable fragment (ScFv) Figure 2: Comparison between the IgG antibody and scFv. Because...Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies are the...10.1016/j.ymeth.2017.01.009 Crivianu-Gaita V, Thompson M (2016) Aptamers, antibody scFv, and antibody...antibody Fab’ fragments: An overview and comparison of three of the most versatile biosensor biorecognition ...

... appear within a range of wavelengths. For that reason, we speak of excitation and emission spectra. Both... happens due to a process called Fluorescence Resonance Energy Transfer (FRET).   Figure 1: Emission...fused to CD45, but is separately expressed. (The reason for having a separately expressed transduction ...difficult. I chose BV421 for the following two reasons: 1) The emission spectrum of BV421 is far enough...

...GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...

... something is working for you, then there is no reason to change it. But what if a kit isn’t working for...variety of manufacturers. It also includes a rough comparison of list price between these manufacturers, as...kits before deciding which one to buy. Table 3: Comparison of popular plasmid purification kit options ...blog post was written by Ashley Waldron, Hannah Dotson, and Nyla Naim. Resources Additional resources...