Skip to main content

We narrowed to 730 results for: SON

Showing: 241 - 260 of 730 results
  1. Viral Vectors 101: The Retroviral Lifecycle

    Type
    Blog Post
    ... yet retroviruses are RNA-containing viruses  (Robinson et al., 1965)! You may be beginning to realize...Brian O'Neill, with thanks to Addgenie Rebecca Hutcheson for her assistance with lentiviral replication...PMID: 26225354. PubMed Central PMCID: PMC4515362 Robinson, W. S., Pitkanen, A., & Rubin, H. (1965). The ... PMCID: PMC355630 Faras, A. J., Taylor, J. M., Levinson, W. E., Goodman, H. M., & Bishop, J. M. (1973)...
  2. Negotiating Work and Life: How to Find the Joy

    Type
    Blog Post
    ...maximise the time you are enjoying both work and personal life. There are no easy answers to negotiating...my colleagues and me. To that end, here are my personal 10 commandments for making it all work – most ...the “jobs” that take you away from having your personal time. Someone else can clean your house, pick ...you can’t make it to dinner this week. One swim lesson missed can mean a world of mental relaxation. And...
  3. Save Time with Transient Plant Leaf Transformations

    Type
    Blog Post
    ...biologist some time… months, in fact. In the Lee-Parsons lab, we are investigating how the production of...protein of interest. Find all plasmids from the Lee-Parsons lab. Test different leaf infiltration methods ...(Germany), before starting his work in the Lee-Parsons Lab.     References D'Aoust, Marc-André, et al.... De Ruijter, N. C. A., et al. "Evaluation and comparison of the GUS, LUC and GFP reporter system for gene...
  4. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...10.1038/nature09523  Ibraheim R, Song C-Q, Mir A, Amrani N, Xue W, Sontheimer EJ (2018) All-in-one adeno-associated...can be turned off by anti-CRISPR proteins. The Sontheimer lab used NmeCas9 with AAV to edit two different...0  Kim E, Koo T, Park SW, Kim D, Kim K, Cho H-Y, Song DW, Lee KJ, Jung MH, Kim S, Kim JH, Kim JH, Kim ...
  5. Fluorescent Proteins 101: Aptamer Fluorophores

    Type
    Blog Post
    ...fluorescent biosensors. Aptabeacons Fluorescence resonance energy transfer (FRET) technology has been studied... sensitive detection assay. In 1999, Grate and Wilson paired laser cleavage and an RNA aptamer that bound... May 15;26(9):3725-36. PubMed PMID: 21419619. 9. Song, Kyung-Mi, et al. “Aptamers and Their Biological... 22368488. PubMed Central PMCID: PMC3279232. 10. Song, Shiping, et al. “Aptamer-based biosensors.” TrAC...
  6. Plasmids 101: Stringent Regulation of Replication

    Type
    Blog Post
    ...restraining further replication.   Figure 3: Comparison of replication regulation mechanisms of stringently...regulation! This post was originally written by Jason Niehaus in December 2015 and was updated by Emily...464.1998 Grimwade, J. E., Rozgaja, T. A., Gupta, R., Dyson, K., Rao, P., & Leonard, A. C. (2018). Origin recognition.../doi.org/10.1093/nar/gky457 Park, K., Han, E., Paulsson, J., & Chattoraj, D. K. (2001). Origin pairing...
  7. Transferable Skills Guide: Creativity

    Type
    Blog Post
    ...relevant to you. Elect a devil’s advocate. This is the person whose job it is to disagree with the group. They...sure we have all experienced a meeting where one person speaks up after a group consensus and is immediately...entire company. It is important to note that the person who submitted the idea did not have to be in charge...always done it this other way,” you probably have reason to continue advocating for your idea. Our product...
  8. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...host tropism of your virus, there are many other reasons when you might pseudotype your virus:  Lowering...a cell surface to endocytose into the cell. The reason VSV-G is so commonly used is that it is good at...Sandoval, 2017). This high titer is one of the reasons VSV-G is used to transduce stem cells and neurons...https://doi.org/10.1093/hmg/10.19.2109 Sandrin V, Boson B, Salmon P, Gay W, Nègre D, Le Grand R, Trono ...
  9. March for Science

    Type
    Blog Post
    ...believe GMOs are safe for human consumption in comparison to 37% of the general public (5, 6). Similarly... the public (8–13). Facing the possibility that reason is losing ground in public discourse, many scientists...politicians to interpret it for them. Other popular reasons to march include: General inclusion of science...policy should have more weight than how any one person feels about it. And yet research shows that thoughts...
  10. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

    Type
    Blog Post
    ...progeny are produced (Figure 1).  Figure 1: Comparison of the life cycle of a lentiviral vector with...integrase-deficient lentiviral vectors? There are several reasons why you might choose an IDLV over a lentiviral ...This blog post was written by Addgenie Rebecca Hutcheson.   References and resources References Banasik...PMC2835240 Wu Y. (2004). HIV-1 gene expression: lessons from provirus and non-integrated DNA. Retrovirology...
  11. Tips for Getting a Faculty Position

    Type
    Blog Post
    ... make the best case for your candidacy. A major reason that a lot of candidates either get no interviews...understand your cover letter and research statement. My personal litmus test was whether my wife could explain ... please introduce yourself to me by email or in person. If you feel compelled to repay me in some way,...job searches. If you feel the urge to repay me personally, I will gratefully accept a very hoppy pint of...
  12. Using Phosphoserine to Study Protein Phosphorylation

    Type
    Blog Post
    ...fellow at the Morgridge Institute for Research in Madison, Wisconsin. It is commonly cited that approximately...enzyme function, protein interaction, etc. by comparison to non-phosphorylated or ‘wild type’ control ...dephosphorylation reaction can be tracked through the comparison of phospho:non-phospho species on PhosTag gels...fellow at the Morgridge Institute for Research in Madison, Wisconsin. She is particularly interested in the...
  13. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...nuclear- or DNA-binding proteins, you may need to sonicate your lysates in order to release the proteins ...you’re using chemical blockers, you can run a comparison of different formulations instead of concentrations...temperature, and/or buffer to increase lysis Add sonication step to protein lysis Splice variants Check...lysing buffer/adjust lysing buffer strength Sonication based lysing protocol Subcellular fractional...  Rachel Leeson...
  14. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...Addgene. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA...publication at Addgene. Maeder ML, Angstman JF, Richardson ME, Linder SJ, Cascio VM, Tsai SQ, Ho QH, Sander...Sander JD, Reyon D, Bernstein BE, Costello JF, Wilkinson MF, Joung JK (2013) Targeted DNA demethylation... this publication at Addgene. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein...
  15. With an Eye Towards the Future, We Look Back at the March for Science

    Type
    Blog Post
    ... work, funding for science, and numerous other reasons. It is important to remember that we, scientists...Albany, NY, USA 42.6526°N 73.7562°W – Nicholas Thompson Over the last few years, there's been a disturbing...positive event that I hope happens again. Nicholas Thompson is a PhD Candidate studying Nuclear Science and...enforcement, and, although there was at least one person vocally protesting us, he was not threatening in...
  16. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ...Many thanks to our guest blogger, Doug Richardson! Doug Richardson is the Director of the Harvard Center...This post was contributed by Doug Richardson, Director of the Harvard Center for Biological Imaging and... 2, 932-940 (2005). PubMed PMID: 16299478. 9. Richardson DS, Lichtman JW. Clarifying Tissue Clearing. ...
  17. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...Single-chain variable fragment (ScFv) Figure 2: Comparison between the IgG antibody and scFv. Because...Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies are the...10.1016/j.ymeth.2017.01.009 Crivianu-Gaita V, Thompson M (2016) Aptamers, antibody scFv, and antibody...antibody Fab’ fragments: An overview and comparison of three of the most versatile biosensor biorecognition ...
  18. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ... appear within a range of wavelengths. For that reason, we speak of excitation and emission spectra. Both... happens due to a process called Fluorescence Resonance Energy Transfer (FRET).   Figure 1: Emission...fused to CD45, but is separately expressed. (The reason for having a separately expressed transduction ...difficult. I chose BV421 for the following two reasons: 1) The emission spectrum of BV421 is far enough...
  19. Sequencing Primers

    Type
    Guide
    ...GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...
  20. Selecting Your Plasmid Purification Kit

    Type
    Blog Post
    ... something is working for you, then there is no reason to change it. But what if a kit isn’t working for...variety of manufacturers. It also includes a rough comparison of list price between these manufacturers, as...kits before deciding which one to buy. Table 3: Comparison of popular plasmid purification kit options ...blog post was written by Ashley Waldron, Hannah Dotson, and Nyla Naim. Resources Additional resources...
Showing: 241 - 260 of 730 results