Skip to main content

We narrowed to 12 results for: SON

Showing: 1 - 12 of 12 results
  1. CRISPR Guide

    Type
    Guide
    ... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer, E. J. (2019)...S., Cofsky, J. C., Kranzusch, P. J., Sontheimer, E. J., Davidson, A. R., Maxwell, K. L., & Doudna, J. ..., J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson, A. R. (2016). Naturally occurring... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti...
  2. Molecular Cloning Techniques

    Type
    Guide
    ...exonuclease. Read more in our Gibson Assembly blog post . Figure 4: Summary of Gibson assembly. Created with ...Cloning Techniques Restriction Enzyme Gateway TOPO Gibson Golden Gate & MoClo Ligation Independent Cloning...cost, availability of starting materials, or just personal preference. Check out our blog on choosing the... = topoisomerase I. Created with BioRender.com. Gibson Assembly (Isothermal Assembly Reaction) Isothermal...Isothermal cloning, more commonly known as Gibson assembly, takes advantage of the properties of three common...enzymes: 5' exonuclease, polymerase, and ligase. In Gibson assembly, DNA fragments with 20–40 base-pair homology...to create one piece of dsDNA. A major benefit of Gibson cloning is that it allows for the assembly of multiple...
  3. Optogenetics Guide

    Type
    Guide
    ...helveticum 500 Chrimson, ChrimsonR Red-shifted channel from Chlamydomonas noctigama ; ChrimsonR carries K176R...research, helping scientists to better understand Parkinson's disease, depression, drug addiction, and more...Mattis, J., Prakash, R., Diester, I., Goshen, I., Thompson, K. R., & Deisseroth, K. (2010). Molecular and... Murata, Y., Kim, S. S., Pulver, S. R., Birdsey-Benson, A., Cho, Y. K., Morimoto, T. K., Chuong, A. S...., O., Fenno, L. E., Prigge, M., Schneider, F., Davidson, T. J., O'Shea, D. J., Sohal, V. S., Goshen, I...
  4. Antibody Guide

    Type
    Guide
    ...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...may need additional processing steps, such as sonication. Denature proteins, using heat and/or chemicals...housekeeping genes). This allows for relative comparison of expression between different samples, by normalizing...normalizing protein expression to the controls before comparison. Alternatively, the samples can be normalized...ChIP protocols use enzyme digestion instead of sonication. This approach is gentler but results in non-...isolated and analyzed. Validation relies on size comparison of peptides. Independent antibody validation ...
  5. Chemogenetics Guide

    Type
    Guide
    ...chemogenetics poster: References Atasoy, D., & Sternson, S. M. (2018). Chemogenetic Tools for Causal Cellular...P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson, S. M. (2011). Chemical and genetic engineering...Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent chemogenetics for research...doi.org/10.1117/1.NPh.11.2.024208 PMID: 38559366 Sternson, S.M., Roth, B.L. (2014). Chemogenetic tools to...doi.org/10.1038/srep14366 PMID: 26399324 Vardy, E., Robinson, J. E., Li, C., Olsen, R. H. J., DiBerto, J. F...A., Pleil, K. E., Mazzone, C. M., Mosier, P. D., Song, J., Kash, T. L., Malanga, C. J., Krashes, M. J....
  6. Adenovirus Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may... Bullard, B. L., Corder, B. N., Gordon, D. N., Pierson, T. C., & Weaver, E. A. (2020). Characterization...Asiedu, C., Geisbert, J., Stanley, D., Honko, A., Johnson, J., Mulangu, S., Pau, M. G., Custers, J., Vellinga...gene and cell-based therapies in the new era of personalized medicine . Genes & Diseases, 4 (2), 43–63. https...window) Luo, J., Deng, Z. L., Luo, X., Tang, N., Song, W. X., Chen, J., Sharff, K. A., Luu, H. H., Haydon...
  7. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...Ravin, S. S., Su, L., Theobald, N., Choi, U., Macpherson, J. L., Poidinger, M., Symonds, G., Pond, S. ...Ridder, J., Allahyar, A., Wang, W., Carpenter, E., Mason, A., Wong, G. K., Cameron, E. R., Kilbey, A., & ...Srivastava, S., Hussain, R., Banani, M. A., Day, W., Stevenson, E., Madigan, M., Chen, J., Khinder, R., . . ....
  8. Plan Your Experiment

    Type
    Guide
    .... D., Dionne, D., Burks, T., Raychowdhury, R., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J....PMID: 35941224 Gilbert, L. A., Horlbeck, M. A., Adamson, B., Villalta, J. E., Chen, Y., Whitehead, E. H...s41594-023-01090-9 PMID: 37783853 Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. ...
  9. Lentiviral Vector Guide

    Type
    Guide
    ...third-generation packaging plasmids. For a summarized comparison of second- and third-generation systems, please... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...doi.org/10.1016/j.biopha.2020.110276 PMID: 32502836 Johnson, N. M., Alvarado, A. F., Moffatt, T. N., Edavettal...
  10. Sequencing Primers

    Type
    Guide
    ...GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...
  11. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...trans-splicing or overlapping vectors: a quantitative comparison . Molecular Therapy, 4 (4), 383–391. https://...
  12. Modular Cloning Guide

    Type
    Guide
    ...assembled by Golden Gate cloning and then combined by Gibson Assembly into acceptor vectors. The Mammalian Toolkit...
Showing: 1 - 12 of 12 results