Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 581 results for: arl

Showing: 241 - 260 of 581 results

  3. Antibodies 101: ELISA (Enzyme-linked Immunosorbent Assay)

    Type
    Blog Post
    ... direct ELISA, aside from the detection step. Similarly, the protein antigen is coated onto the wells ...calculate the protein concentration. Image from Jagarlamudi et al., 2015.   The maximum OD that most ...

  7. A Look at Addgene's QC Process

    Type
    Blog Post
    ...differences are considered a QC issue is reviewed yearly at a best practices meeting, where the QC team ...pipeline. There are regions of plasmids that are particularly difficult to sequence and assemble using the...

  8. CRISPR 101: Targeting Non-Coding RNAs with CRISPR/Cas9

    Type
    Blog Post
    ...Zibitt et al. 2021). Mutating splice sites is particularly effective as it can result in the retention ...used to target lncRNAs with high specificity, particularly in applications requiring smaller delivery systems...

  9. Rabies and Neuronal Tracing

    Type
    Blog Post
    ...Why study neural connectivity? One of the early lessons many of us learned in biology is that the body...Deshpande et al., 2013). The study found that at early time points, most of the projections to these new...

  10. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...experience, the more I heard that getting into industry early would only help. Like any major life decision, ...could be laid off while you’re there. Of course, similarly, an academic advisor could also lose their funding...

  13. PCR Applications for Copy Number Variation Assays

    Type
    Blog Post
    ...dsDNA in most starting materials, and is not particularly sensitive. The fluorescent signal can be affected...be affected by DNA quality and primer design, particularly for amplicons under 100 bp (Ma, 2015.) A schematic...

  14. The AAVantages of AAV in CRISPR Screens

    Type
    Blog Post
    ...may be too constraining for some experiments, particularly in vivo ones. In those cases, AAV vector screens...your CRISPR screen to a high degree. This is particularly helpful when investigating tissue-specific diseases...

  15. Antibodies 101: Conventional vs Spectral Flow Cytometry

    Type
    Blog Post
    ...cytometry (“spectral flow”) has emerged as a particularly useful tool for those wishing to run larger ...Mayo Clinic studying host-microbe interactions in early life.    Resources More resources on the Addgene...

  16. 10 Basic tips for mammalian cell culture

    Type
    Blog Post
    ... close to the hood so you can view your cells regularly (both before entering the hood and when putting...Institute of Colloids and Interfaces. Sana is particularly interested in Glycobiology and Immunology. You...

  17. xCas9: Engineering a CRISPR Variant with PAM Flexibility

    Type
    Blog Post
    ...xCas9 3.7. Base editor variants with xCas9 are similarly flexible. Like the xCas9 3.7 nuclease, xCas9 3.7... and base editing, to more loci. Although these early data are exciting, there’s a lot we still don’t ...

  18. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ...seen some major advances in light microscopy, particularly related to the neurosciences.  These developments...tetrahydrofuran-based tissue clearing (13,14). A few years later, Karl Deisseroth’s lab developed CLARITY, which is a hydrogel-based...

  19. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ...The maturation of the chromophore on many FPs (particularly those derived from GFP) requires oxygen. Therefore...interested in everything related to gene expression, particularly at the RNA level. He maintains the greenfluorescentblog.wordpress.com...

  20. Sequencing Primers

    Type
    Guide
    ...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...
Showing: 241 - 260 of 581 results