Skip to main content
Addgene

We narrowed to 556 results for: SPR

Showing: 261 - 280 of 556 results
  1. Mesothelioma - Causes, Symptoms, and Treatment

    Type
    Blog Post
    ... in size and may have spread while Stage 4 indicates that the cancer has spread from where it originated...the time it has caught it has usually started to spread (metastasize) and turned into Stage 3 or Stage ...chemotherapy to kill cancerous cells that may have spread beyond the point of origin, and radiation to stop...any other abdominal organs to which it may have spread. Then, the surgeon performs a heated chemotherapy...cancer earlier, in particular before it starts to spread beyond its point of origin. One of the most exciting...
  2. 8 Great Depositor Research Stories

    Type
    Blog Post
    ...their new CRISPR tools, Cas7-11, a low-toxicity RNA editing tool, and PASTE, a drag-and-drop CRISPR editing...minimal payloads!) Uncovering Ancestral Bias in CRISPR Research: We spoke to researchers from the Boehm...post on their paper uncovering ancestral bias in CRISPR guide library design.  dCas9-directed DNA Demethylation... how to use dCas9 (with no modifications!) as a CRISPR/dCas9-based tool for DNA demethylation. AAV Q&A...
  3. Zebrafish Plasmid Collection

    Type
    Collection
    ...Collection CRISPR Please refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology...examples of useful zebrafish CRISPR resources can be found below: UFlip CRISPR targeted integration vectors...for Targeted Integration Using CRISPR/Cas9 - Jeffrey Essner Lab CRISPR-Cas/RNA-Guided Nuclease (RGN) expression...Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9 Vector...modified CRISPR-Cas9 system - Shuo Lin Lab Re-purposed Ac/Ds transgenic system enabling CRISPR/dCas9-interference...for the laboratory use of zebrafish. CRISPRz - A database of CRISPR/Cas9 target sequences that have been...morpholinos, zinc finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart...
  4. Plasmids 101: Gibson Assembly and Other Long-Homology Based Cloning Methods

    Type
    Blog Post
    ...mixing and matching of parts. Gibson assembly meets CRISPR Gibson can be adapted to more complicated cloning...use of Gibson assembly combined with the popular CRISPR technology and is described in a recent publication...second example of using Gibson Assembly along with CRISPR was also described recently (Jiang et al. 2015)...chromosome (up to 100 kb) were specifically cut out via CRISPR and then assembled into a vector using Gibson assembly...homology with the bacterial chromosome fragments. CRISPR cutting was used to circumvent the need to PCR ...Wang A, Li K, Wang B, Jin S, Reiser M, Lockey RF. CRISPR/Cas9 nuclease cleavage combined with Gibson assembly...
  5. Editor's Choice, July 2016

    Type
    Blog Post
    ...do with CRISPR, our most popular post in July (with over 700 views) was an update on new CRISPR genome ...can use to monitor cellular perturbations to how CRISPR has made it much easier to generate mouse models...can find in the post, may make Cpf1 the preferred CRISPR variant going forward.   Special Delivery Fluorophore...Microbe 2016 Conference Generating Mouse Models Using CRISPR/Cas9 Cpf1 Update: Comparison to Cas9 and NgAgo ...
  6. Addgene’s Top 10 Blog Posts from 2014

    Type
    Blog Post
    ...and improved. The CRISPR posts written by our guest bloggers, the experts in the CRISPR/Cas field, have ...past year. A quick glance shows that interest in CRISPR continues to grow as the genome editing technique...Popular Posts of 2014 How to Design Your gRNA for CRISPR Genome Editing By John Doench (Guest Blogger) ...Plasmids 101: Yeast Vectors By Marcy Patrick CRISPR-Cas9 FAQs Answered! By Caroline LaManna Plasmids...
  7. Plant Plasmids and Resources

    Type
    Collection
    ... Addgene! CRISPR Please refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology...like... Plant CRISPR resources Fluorescent Protein Guide Addgene Blog: Plant Biology CRISPR Cloning Transcription...Rice - Yinong Yang. The MoClo CRISPR/Cas Toolkit for Plants includes CRISPR/Cas nucleases, base editors,...technology or the Plant CRISPR Resources for a full selection of plasmids expressing different functional variants... gRNA backbones. A few examples of useful plant CRISPR resources include: A Multipurpose Toolkit enables...truncatula , wheat, and barley - Daniel Voytas. A CRISPR/Cas9 Toolkit for use in a variety of plant species...series of vectors and DNA modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes...
  8. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...piggyBac™ Transposon Catch up on Everything CRISPR with Our CRISPR Guide Deposit Your piggyBac™ Vectors! ... to the development of site-specific nucleases (CRISPR/Cas9, TALENs, and ZFNs). However, several challenges...piggyBac™ transposon system can be combined with CRISPR/Cas9 to efficiently perform genetic manipulations...interest, along with a site-specific nuclease (such as CRISPR/Cas9) to create a double-stranded DNA break. After...technologies including Zinc Fingers, TALENs, and CRISPR-Cas9 nucleases. Mathew applies his specialized ...
  9. Microbiology Resources

    Type
    Collection
    ...Microbiology General CRISPR Resources Read our CRISPR Guide for a general introduction to CRISPR technology. Check...software. Addgene yeast CRISPR resources Bacterial CRISPR Resources The CRISPR technology was developed...synthetic biology. CRISPR Resources : Find essential background information on using CRISPR in your lab, specific... Check out our CRISPR reference page for CRISPR resources, such as depositor protocols and gRNA design...Find CRISPR tools for use in genome editing of bacteria. CRISPathBrick Multiplex Plasmid : CRISPR expression... specific CRISPR tools for genome editing in bacteria, and more. Synthetic Biology : Browse our deposited...editing is not always straightforward. Read our CRISPR Methods for Bacterial Genome Engineering blog post...
  10. Lentiviral Prep Service

    Type
    Collection
    ...Packaging Service page . Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes...gRNA pooled library in lentiCRISPRv2 Human sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes...92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa sgRNA activation...libraries 92385 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set A Human CRISPR inhibition library...Root 92386 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set B Human CRISPR inhibition library...genes. For more information on CRISPR plasmids and function, see our CRISPR plasmids resource page . Cas9...Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding Libraries Control...
  11. Why and how to start studying chromatin (with Addgene's help)

    Type
    Blog Post
    ...Chromatin Interactions: Using CRISPR-dCas9 to Study Gene Regulation CRISPR 101: Epigenetics and Editing...Studying Protein-DNA Interactions CRISPRainbow and Genome Visualization CRISPR Between the Genes: How to Experiment...or DNA repair, or replication, or any number of CRISPR applications and thought “OK, but how does this...
  12. Expanding the Targeting Scope and Editing Efficiency of Adenine Base Editors

    Type
    Blog Post
    ...editing Read more about CRISPR Learn all the basics about CRISPR in our CRISPR 101 blog series Resources... Cell Symposia: Gene- and Cell-based Therapies: CRISPR, Stem Cells, and Beyond meeting earlier this month...Addgene.org Find base editors for your research Read our CRISPR guide Find plasmids for your research ...
  13. Top Requested Lentivirus and AAV of 2016

    Type
    Blog Post
    ...lentiviral inventory is based on CRISPR tools, though we do provide a few non-CRISPR related viral preps. Cas9...Cas9 is the headliner of most CRISPR applications and can be expressed from your cell line of choice after...can then be used both for screens (using pooled CRISPR knockout libraries) and individual gene knockouts... Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. PubMed...
  14. Hot Plasmids - February 2022

    Type
    Blog Post
    ... Penn State Protein Ladder Engineered miniature CRISPR-Cas system for mammalian genome regulation and ...gene perturbation by: Gabrielle Clouse While many CRISPR-based genetic screening methods have primarily ...10.1038/s41598-021-96051-x Engineered miniature CRISPR-Cas system for mammalian genome regulation and ...and editing by: Rachel Leeson The large size of CRISPR-Cas effectors and fusion proteins, such as Cas9 and...engineering applications. CasMINI, a new miniature CRISPR-Cas system for editing and gene activation, is ...
  15. Design Tips for Prime Editing

    Type
    Blog Post
    ...Download the CRISPR 101 eBook Resources on Addgene.org Read the CRISPR guide Find CRISPR plasmids by ...editing guide RNA (pegRNA). The pegRNA consists of a CRISPR gRNA extended to include a primer binding site ...Prime Editing: Adding Precision and Flexibility to CRISPR Editing PRIDICT: Predicting Efficiencies of Prime...
  16. Ras Pathway

    Type
    Collection
    ...factor SPRED SPRED1 SPRED2 SPRED3 Sprouty related, EVH1 domain containing SPRY SPRY1 SPRY2 SPRY3 SPRY4 ...SPRY4 Sprouty RTK signaling antagonist STK STK3 STK4 Serine/threonine kinase STK11 Serine/threonine kinase...
  17. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...genomes using exogenous enzymes: Lambda red and CRISPR Developed over the past 20 years, Lambda Red recombineering...used  (Thomason et al., 2014). In recent years, CRISPR-Cas9 technology has also aided in the creation ... "RNA-guided editing of bacterial genomes using CRISPR-Cas systems." Nature biotechnology31.3 (2013): ...15109831. Pyne, Michael E., et al. "Coupling the CRISPR/Cas9 system with lambda red recombineering enables...blog Read our Plasmids 101 blog posts Find our CRISPR blog posts Learn more about Lambda Red recombineering...
  18. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...
  19. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ...(Mouse IgG2a) Goat anti-mouse IgG2a CASPR anti-CASPR mAb K65/35 (Mouse IgG1) Goat anti-mouse...Neocortex labeled with anti-pan-Nav (magenta), anti-CASPR (green), and anti-Kv2.1 (cyan). (B) Cerebellum labeled...Neumann, E., De Caestecker, M., Gutierrez, D., & Spraggins, J. (2022). Multiplex Immunofluorescence on Fresh...Yong (Ed.), Biobanking (Vol. 1897, pp. 299–311). Springer New York. https://doi.org/10.1007/978-1-4939-8935...
Showing: 261 - 280 of 556 results