We narrowed to 271 results for: transfer

... lipoic acid ligase, biotin ligase, phosphopantetheinyltransferase) – These enzymes catalyze the covalent...

...peptide-based proteosome inhibitors, glutathione S-transferase (GST), which can be fused to recombinant proteins...

...Thompson, and Thomas D. Gilmore. "Histone acetyltransferases and histone deacetylases in B-and T-cell ...

...the training they receive as postdocs is not transferrable to other environments. Slide from Paula Stephan...

...(LAMP5) — as well as cholinergic (choline acetyltransferase, ChAT) neurons. The authors characterized ...

... a targeting sequence for the adenine phosphoribosyltransferase (APT) gene, which is conserved in many...

...capping enzyme superfamily of covalent nucleotidyltransferases." Current opinion in structural biology...

...activation domain (SAD), which recruits histone acetyltransferase to open chromatin, improved editing efficiencies...

...expression - demonstrating light-induced silencing of transferrin receptor CD71 in HeLa cells.   Comparison of...

...receptor 1B MEL-1B-R, MT2 NAMPT nicotinamide phosphoribosyltransferase 1110035O14Rik, DKFZp666B131, MGC117256...

...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...