Skip to main content

We narrowed to 10 results for: transfer

Showing: 1 - 10 of 10 results
  1. Lentiviral Vector Guide

    Type
    Guide
    ...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — ...activate the promoter on the transfer plasmid. Many of the lentiviral transfer plasmids that have been deposited...three (or four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA ... First-generation plasmids include (Figure 2): Transfer plasmid — contains transgene and wild-type LTRs...tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat for activation....Second-generation plasmids include (Figure 3): Transfer plasmid — contains transgene and wild-type LTRs... contains env All second-generation lentiviral transfer plasmids must be used with a second-generation...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...plasmids containing the transfer, envelope, or packaging components. The transfer plasmid encodes the gene...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA ...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...plasmids described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging...events occur between the packaging, envelope, and transfer plasmids, and that resulting construct is packaged...virus after the initial infection. Some retroviral transfer plasmids that have been deposited with Addgene...
  3. Adenovirus Guide

    Type
    Guide
    ...need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest...recombination between the transfected adenoviral transfer plasmid and the E1 region integrated in the packaging...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...recombination of unstable regions, like the ITRs found in transfer plasmids. This will ensure that the repeats will...that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack) — containing the transgene...rAdV vector construction, due to their high gene transfer efficiency. Other serotypes like Ad26 and Ad35...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...produce rAAV vectors, three plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing...transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with most standard cloning...restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction sites or...recombination of unstable regions, like the ITRs found in transfer plasmids. This will ensure that the repeats will...Reference . Production The three production plasmids (transfer, packaging, and helper plasmid) are transfected...longer transgene is broken down between two AAV transfer plasmids and packaged in separate rAAV vectors...disease in humans. Most, if not all of Addgene’s transfer plasmids are replication deficient. These plasmids...
  5. Addgene's eBook Collection

    Type
    Guide
    ...and management, resources for identifying your transferable skills, and tips on the job application process...
  6. Promoters

    Type
    Guide
    ...RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA), the adaptor molecules that are responsible...
  7. CRISPR Guide

    Type
    Guide
    ...libraries are a heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains ...then cloned in a pooled format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector...short 3′ overhang, allowing for directional gene transfer, which may increase the efficiency of gene editing... Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers...
  8. Molecular Biology Reference

    Type
    Guide
    ...bacterium to another by a type of horizontal gene transfer called conjugation. Like chromosomal DNA, plasmid...
  9. Antibody Guide

    Type
    Guide
    ... an SDS-PAGE gel to separate proteins by size. Transfer proteins from the gel to a membrane. Incubate ...
  10. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...
Showing: 1 - 10 of 10 results