We narrowed to 960 results for: ARC
-
TypeCollection...and 63AA, respectfully). This next generation architecture has been shown to increase mutation induction...cells, (iv) an improved, truncated TALE backbone architecture as established by Miller et al. (PMID: 21179091...
-
Bacterial Expression Systems
TypeCollection...replicate plasmids of all types, but beyond that, researchers also use bacteria as model systems to answer ...Addgene distributes many plasmids that can help researchers plan their experiments using bacterial expression... -
Validated gRNA Sequences
TypeCollection...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut... -
Synthetic Biology - Browse Plasmids
TypeCollection...email [email protected] . Synthetic Biology Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Algal
TypeCollection...biology plasmids for use in algae. Algal Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Bacterial
TypeCollection...plasmids for use in bacteria. Bacterial Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Fungal
TypeCollection...biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Mammalian
TypeCollection...for use in mammalian systems. Mammalian Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Plant
TypeCollection...biology plasmids for use in plants. Plant Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Worm
TypeCollection...biology plasmids for use in C. elegans. Worm Plasmids Search the table by keyword or sort by the table headings...