Skip to main content

We narrowed to 532 results for: abo.3

Showing: 301 - 320 of 532 results
  1. Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?

    Type
    Blog Post
    ... et al. designed gRNAs to target the HIV-1 5’ and 3’ LTRs and expressed them along with Cas9 in the T-...eradicating HIV-1/AIDS. J Neurovirol. 2015 Jun;21(3):310-21. PubMed PMID: 25716921. Additional Resources...reservoirs, chronic inflammation, and negative metabolic effects of ART. Why can’t the body mount an immune...
  2. SciComm with the Experts at Science in the News Part 2

    Type
    Blog Post
    ...Blog (other programs are discussed below). Chpater 3: SITN Popularity and Events - Amy discusses some of...To learn more about the STIN's podcast, email [email protected]    For more info about starting your...evens where scientists can grab a beer and chat about their work at a local bar. It doesn't have to be...1: Introduction - Vini and Amy tell us a little about themselves. Chapter 2: What is Science in the News...science communicators. In this chapter we learn about some of their events - science seminars, science...the lab and working with SITN. She points to collaboration and delegating as keys achieving success. Chapter...your own SciComm organization and to learn about some of SITN's other initiatives, email [email protected]...
  3. Our Most Popular Blog Posts from 2019

    Type
    Blog Post
    ...for making scientific graphics. PS: they’re free. 3. Fluorescent Proteins 101: GFP Fusion Proteins - Making...mNeonGreen, mTFP1, and mWasabi by Jennifer Tsang Learn about mNeonGreen, mTFP1, and mWasabi and find plasmids...Broccoli, Spinach, and Corn, for example. Learn more about the aptamer soup in this blog post. 5. Five Popular...
  4. Three Tips to Organize Your Lab Notebooks in the New Year

    Type
    Blog Post
    ... bar to quickly find what you’re looking for. Tip 3: Share protocols and spreadsheets with lab members...experiments before the next R01 is due. But what about organizing yourself and your lab? Organizing your...
  5. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...tissue-penetrating wavelength above 600 nm. LumiFluors Schaub, F.X., et al. (3) designed two imaging probes...PMID: 27465542. PubMed Central PMCID: PMC4974478. 3. Schaub, F.X., et al. (2015) Fluorophore-NanoLuc BRET...Blog Learn more about FRET Tips for Using FRET in Your Experiments Learn more about Fluorescent Protein...heme-containing proteins in whole animals, light at or above 600 nm wavelengths should be used. Researchers often...be excited by NanoLuc® luciferase (NLuc) and set about to create an in vivo imaging reporter by linking...
  6. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ... Transcriptional repression DNA Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9...available as ready-to-use lentivirus. Figure 3: dCas9-DNMT3A methylates cytosines at promoters and...modifications. Like the TALE-LSD1 system described above, dCas9-LSD1 inactivates targeted enhancers. Although...setting up your experimental system. Let us know about your experience with these constructs in the comments...
  7. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ... leaving behind any accessory DNA sequences [2], [3]. Simply put, the piggyBac™ transposon containing ...PMID: 26702451. PubMed Central PMCID: PMC4686154. 3. A. M. Singh, D. W. Perry, V. V. A. Steffey, K. Miller...transposase itself, please read on to learn more about this exciting technology from the folks at Transposagen...Additional Resources on the Addgene Blog Learn about the Sleeping Beauty Transposase Read up on Genome...
  8. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...variants. Klapoetke et al., Nat Methods 2014 Mar 11;(3):338-46. For more information and descriptions of...counterparts. The Janovjak lab has deposited their 3 Opto-RTK constructs – Opto-mFGFR1, Opto-hEGFR, and...turn green. Mashiko et al., Sci Rep 2013 Nov 27; 3:3355. Rinehart lab reagents for improved expression...96-102. Druckmann et al., Neuron. 2014. Feb 5;81(3):629-40.  Next-Gen Brainbow toolkit for neuronal...2012 Mar 20;109(12):E690-7. For further reading about SpyLigase technology, read the Addgene interview...; DOI: 10.1021/sb4001504. For further reading about Nicola Patron's MoClo kit and her plant synbio research...in optimizing TALEN assembly and activity? The laboratory of Takashi Yamamoto has created a complete TALEN...
  9. Changing Labor Laws Bring Increased Postdoc Wages

    Type
    Blog Post
    ...be automatically adjusted every 3 years. In May 2016, Secretary of Labor Thomas Perez updated the overtime...the Addgene Blog How did this change in labor laws come about? In March 2014, the White House issued a...must be above this level, and certain job duty tests must be met. In the Department of Labor’s general... to $47,476 per year, under updates to the Fair Labor Standards Act (FLSA). This is having a major effect...ensuring that either all affected scientists are paid above this threshold or for tracking the hours that these... a memorandum to the Secretary of Labor to update the FLSA, which had not seen revisions since 2004. In... In July 2015, the Department of Labor issued a Notice of Proposed Rulemaking, soliciting feedback by ...
  10. Technical Design of a Western Blot

    Type
    Blog Post
    ...Tris-acetate 40–500 kDa Tris-tricine 150 V, 1–3 hours Good for higher weight proteins Long running...very large proteins. A semi-dry transfer is faster — 3–30 minutes — and uses less buffer, but it is not as...approaches best suit your experimental needs. Table 3: Optimizing the technical design of a western blot...If you’ve ever run a western blot, or thought about running one, you’ll know there’s a lot of choices...
  11. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...cyanobacterium Vampirovibrio chlorellavorus." PeerJ 3 (2015): e968. PubMed PMID: 26038723. PubMed Central... Additional resources on the Addgene blog Read about company culture at Addgene See some of our previous...
  12. 6 Steps to Submitting a Resume That Gets Seen

    Type
    Blog Post
    ...for more on timely submission of a job application. 3) Read job descriptions carefully Be open minded and... your strengths in your resume and don't be shy about asking for help. The worst thing that can happen...
  13. The Stingy Scientist: How the Baby Gel Box Was Born

    Type
    Blog Post
    ...to wash Eppendorf tubes which were to be used for 3 months before they could be discarded.  Seeding Labs...Reddit AMA  Few of us spend much time thinking about conserving resources in the labs. Disposable plastic...Dudnik, Founder of Seeding Labs, tells the story about working as a student in a rice lab in the Ivory ...didn’t feel the need to reuse plasticware or think about conserving reagents and buffers.  However, I had...environmentally conscious friends who had me thinking about energy conservation even before it was a popular...Turns out, one could make a lifetime supply for about $10 US dollars worth of glass powder pruchased from...So, I designed my own gel box (see illustration above) and bribed the guys in the hospital machine shop...
  14. A Better Way to Get Customer Support: The Help Center

    Type
    Blog Post
    ...it doesn’t help much if the actual response takes 3 days and still doesn’t even answer your question. ...not even get a solution to the problem you called about. Next, you try an email, given that this is the ...” next to an encircled question mark (see image above). This useful widget allows you to access our Help... or you just have a general question or concern about the answers we provide, within the widget you also...Addgene Blog Read other Inside Addgene Posts Learn about New Features on Our Plasmid Pages Resources at ...
  15. We're Updating Our Hold for Publication Policy

    Type
    Blog Post
    ... a journal publication. Plasmids will be released 3 years after the deposit date. Don’t worry, we’ll ... in the hold status and reach out to depositors about them, but we all know how easy it is to miss an ...happy to distribute unpublished materials. What about preprints? Addgene supports preprints and encourages...appreciate your feedback. If you have questions about depositing, check out our website, Help Center, ...
  16. Viral Vectors 101: Parts of the AAV Packaging Plasmid

    Type
    Blog Post
    ...plasmid, which contain regions of dsDNA. To generate a 3’ hydroxyl group needed for DNA replication, Rep78/...engineered Learn about the parts of the AAV transfer plasmid  Resources on Addgene.org Learn about AAV Find ...plasmid! Check out this blog post to learn more about the AAV transfer plasmid! References: Naso MF...
  17. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' Note: If you plan to...CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other oligo),...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate ...
  18. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ...C-terminus (3xHA, 13xMyc, GST, or GFP). Longtine et al.(3) describe a complimentary set of plasmids for use ...strain. In addition to the collections featured above, many other modular yeast tagging systems have been...Addgene would love to hear from you, our community, about your experience with yeast genome modifications....
Showing: 301 - 320 of 532 results