We narrowed to 451 results for: CRISPR
-
TypeCollection...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson...
-
Validated gRNA Sequences
TypeCollection...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens... -
AAVs in Retinal Gene Therapy
TypeBlog Post...trials for prevalent diseases - to name a few. CRISPR-based tools are also particularly well suited to.... Yu W and Wu Z., 2018. In vivo Applications of CRISPR-Based Genome Editing in the Retina. Front Cell ... -
How to Write a Scientific Review Article
TypeBlog Post...Compiled Info on New Plasmids Review the CRISPR Field with Our CRISPR Guide Pages ... -
Hot Plasmids: Summer 2025
TypeBlog Post... TnpB, so hot right now By Alyssa Shepard While CRISPR has become a household name, the search for smaller...more in our recent blog post on TnpB). Similar to CRISPR-Cas, TnpB is directed to genomic targets using ... -
Antibiotic Resistance: An Old Solution but a New Problem
TypeBlog Post...recent blog post on CRISPR antimicrobials to learn how scientists are using CRISPR to fight bacteria. ... -
Addgene’s Blog Gets a New Look!
TypeBlog Post...showcases the five main topics of the blog: Plasmids CRISPR Viral Vectors Fluorescent Proteins Science Careers... -
Addgene’s Newest Way to Speed Your Research: The Cloning Grade DNA Service
TypeBlog Post...mammals), cloning techniques, and experimental use (CRISPR, viral production, RNAi, protein expression etc... -
Ghanaian Researchers to Receive Plasmid Awards from Addgene and Seeding Labs
TypeBlog Post... to use the expertise he’s developed as well as CRISPR-based gene repression tools to find and test genes... -
Deep Mutational Scanning with One Pot Saturation Mutagenesis
TypeBlog Post...Mutations in Your Plasmids Learn How You Can Use CRISPR Pooled Libraries to Generate Mutant Populations...Addgene.org Find Plasmids from the Whitehead Lab Use CRISPR Pooled Libraries to Generate Mutants ... -
Twenty Years of Sharing: Addgene's Viral Vector Service
TypeBlog Post... may recall our first 20th anniversary story on CRISPR, where we dove fairly deeply into the different...Practical Considerations for Using Pooled Lentiviral CRISPR Libraries. Current Protocols in Molecular Biology... -
2022 and 2023: Reflections and Looking Forward
TypeBlog Post... distributed 165,000 plasmids, including 27,000 CRISPR plasmids and 6,000 biosensors plasmids. Our most... -
Download Science-Themed Zoom Backgrounds from Addgene
TypeBlog Post... lentiviral preps for COVID-19 research, pooled CRISPR lentiirus libraries, pooled barcoding libraries... -
Synthetic Biology, Artificial Chromosomes, iGEM & More - Interview with Tom Ellis
TypeBlog Post...things like DNA synthesis, Golden Gate cloning, and CRISPR. The yeast synthetic genome project and constructing... -
Inntags: Innovative Protein Epitope Tagging
TypeBlog Post...the Inntag Plasmids Tag endogenous proteins with CRISPR Fluorescently Tag Your Protein of Interest ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...Tumor Suppressor Gene CRISPR Knockout Library CRISPR Sidi Chen Use this AAV CRISPR knockout library expressing...Plasmid Collection Monosynaptic Neuronal Tracing CRISPR Plasmids and Resources Content last reviewed on... -
Designer PUF Proteins for Any RNA Target
TypeBlog Post...With the meteoric rise of CRISPR technology, the ability to direct enzymes – from nucleases to transcription... -
Modulate the Activity of 17 Signaling Pathways with One Kit!
TypeBlog Post...Has Been Used in Cancer Lineage Tracing Read How CRISPR Can Be Used in Genome-Wide Screening Browse 28 ... -
SciComm with the Experts at Science in the News Part 2
TypeBlog Post... of the topics they've recently covered inlcude CRISPR, mosquitoes, allergies, & more! We briefly answer... -
Editor's Choice, September 2016
TypeBlog Post...Needed to Navigate a Scientific Enterprise in Flux CRISPR Kinome Libraries Available: Pooled and Individual...