Skip to main content

We narrowed to 562 results for: Spr;

Showing: 321 - 340 of 562 results
  1. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

    Type
    Blog Post
    ...purposes, like creating stable cell lines, delivering CRISPR/Cas9 to cells for genome editing, and introducing... is gradually reduced. For example, after using CRISPR/Cas9 to edit a gene, the expression of Cas9 is ...High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology...
  2. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ... Gilbert Labs have previously deposited their CRISPRoff system — a programmable epigenetic editor consisting...deposited with Addgene. These variants, including a “miniCRISPR” version, are much smaller proteins than SpyCas9...Genome-wide programmable transcriptional memory by CRISPR-based epigenome editing. Cell, 184(9), 2503–2519...
  3. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...
  4. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-CASPR/Neurexin IV [K65A/2R] CASPR/Neurexin IV Mouse IgG2a 206606 Anti-CASPR2 [K67/11R] CASPR2 Human...177445 Anti-CASPR/Neurexin IV [K65/35R] CASPR/Neurexin IV Rat Mouse IgG2a 177446 Anti-CASPR2 [K67/25R] ...219448 Anti-CASPR/Neurexin IV [K65A/30R] CASPR/Neurexin IV Rat Mouse IgG2a 219449 Anti-CASPR/Neurexin IV...SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin IV [K66/38R] CASPR/Neurexin IV Rat Mouse IgG2a 128626...VAPA Rat Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404...external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin IV Rat Mouse IgG1 206684...K28/77R] PSD-95 Human Mouse IgG2a 220381 Caspr [K65/31R] Caspr Rat Mouse IgG2a 220382 KChIP3 K+ channel...
  5. Viral Vectors 101: Optogenetic Tools

    Type
    Blog Post
    ...electrical activity to gene expression, and even CRISPR based gene editing. But, how do you decide which...Photoswitching Proteins (Vol. 2173, pp. 21–51). Springer US. https://doi.org/10.1007/978-1-0716-0755-8_...
  6. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...encodes a Type I-F CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) ...sets the stage for combining the super powers of CRISPR and transposons to allow for the targeted delivery...
  7. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ... first ever CRISPR-based clinical trial in 18 lung cancer patients. This study used CRISPR gene editing...create welcoming environments for tumor cells spreading to other organs during metastasis. Evading Recognition...
  8. Rett Syndrome

    Type
    Collection
    ...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...
  9. AAV for Neuronal Tracing

    Type
    Collection
    ...but new virus cannot spread to any neighboring cells. To enable monosynaptic spread of this deletion-mutant...the virus can spread from this cell to synaptically connected cells (meaning, it can spread to cells that...infected cells, but is required for transynnaptic spread (Wickersham et al., 2007a, Wickersham et al., 2007b...through complementation, G-deleted rabies virus can spread to monosynaptically connected cells. To further...
  10. Neurodegeneration Research Collection

    Type
    Collection
    ...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al..... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...
  11. New Podcast Segment: Hot Plasmids

    Type
    Blog Post
    ...plasmids covered in this segment Hot Plasmid 1: CRISPR X from Michael Bassik's Lab - A new tool for making...localized point mutations. Listen to Our Segment on CRISPR X Hot Plasmid 2: Magneto 2.0 form Ali Guler's Lab...
  12. Resolute Plasmid Collection

    Type
    Collection
    ...Plasmid Gene/Insert Industry PI Pooled Libraries CRISPR and overexpression pooled libraries are useful ...Human SLC Activation Library 132561 Superti-Furga CRISPR activation library targeting human SLC proteins...Human SLC Knockout Library 132552 Superti-Furga CRISPR knockout library targeting human SLC proteins. ...Mouse SLC Knockout Library 141436 Superti-Furga CRISPR knockout library targeting mouse SLC proteins. ...Knockout Libraries 213695 221409 221410 Superti-Furga CRISPR knockout library targeting human transmembrane ...
  13. MassBioEd Career Exploration Day at Addgene

    Type
    Blog Post
    ...Architect Pam McA' Nulty (check out our blog post on CRISPR software to see the importance of programming for...Scientist Joel McDade’s presentation on the emerging CRISPR genome editing technology was a rousing success...
  14. Microbes: Look, Listen, and Tell

    Type
    Blog Post
    ...Resources on the Addgene Blog Read Our Post on CRISPR Methods for Bacterial Genome Engineering Learn ...Addgene.org Check out Our Microbiology Resource Page CRISPR plasmids designed for use in bacteria Deposit Your...
  15. Plasmids for Stem Cell Research

    Type
    Collection
    ...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation...
  16. Three Tips to Organize Your Lab Notebooks in the New Year

    Type
    Blog Post
    ...you’re looking for. Tip 3: Share protocols and spreadsheets with lab members Now that you’ve organized your... may also want to consider moving your paper spreadsheets for reagent storage locations, such as the list...
  17. Supporting Rare Disease Research with BeHeard 2017

    Type
    Blog Post
    ...proteins to monitor the localization of these genes, CRISPR to disrupt their function, and C. elegans overexpression...peritoneal mesothelioma tumorigenesis. They plan to use CRISPR and lentiviral plasmids from Addgene to knockout...
Showing: 321 - 340 of 562 results