Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 561 results for: Spr;

Showing: 321 - 340 of 561 results

  1. Microbiology Resources

    Type
    Collection
    ...Microbiology General CRISPR Resources Read our CRISPR Guide for a general introduction to CRISPR technology. Check...software. Addgene yeast CRISPR resources Bacterial CRISPR Resources The CRISPR technology was developed...synthetic biology. CRISPR Resources : Find essential background information on using CRISPR in your lab, specific... Check out our CRISPR reference page for CRISPR resources, such as depositor protocols and gRNA design...Find CRISPR tools for use in genome editing of bacteria. CRISPathBrick Multiplex Plasmid : CRISPR expression... specific CRISPR tools for genome editing in bacteria, and more. Synthetic Biology : Browse our deposited...editing is not always straightforward. Read our CRISPR Methods for Bacterial Genome Engineering blog post...

  2. Lentiviral Prep Service

    Type
    Collection
    ...Packaging Service page . Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes...gRNA pooled library in lentiCRISPRv2 Human sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes...92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa sgRNA activation...libraries 92385 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set A Human CRISPR inhibition library...Root 92386 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set B Human CRISPR inhibition library...genes. For more information on CRISPR plasmids and function, see our CRISPR plasmids resource page . Cas9...Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding Libraries Control...

  3. Ras Pathway

    Type
    Collection
    ...factor SPRED SPRED1 SPRED2 SPRED3 Sprouty related, EVH1 domain containing SPRY SPRY1 SPRY2 SPRY3 SPRY4 ...SPRY4 Sprouty RTK signaling antagonist STK STK3 STK4 Serine/threonine kinase STK11 Serine/threonine kinase...

  4. Bacterial Expression Systems

    Type
    Collection
    ...with Addgene's CRISPR Guide . Browse CRISPR plasmids available at Addgene through our CRISPR Plasmids and...tools like CRISPR-Cas9 are not only valuable but often essential. Find a collection of CRISPR plasmids ...Bacterial CRISPR Plasmids page . Additional Addgene Genome Engineering Resources Learn more about CRISPR with...zinc finger proteins. Addgene Blog CRISPR Methods for Bacteria CRISPR-based Genome Editing Systems For ...Empty Backbones Collection Molecular Biology Guide CRISPR Guide Bacteria are commonly used to create, store...ratio) Escherichia coli Christopher Voigt 65008 pCRISPReporter-mCherry Promoter activity Fluorescence (mCherry...coli INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons Return to top Content last reviewed...

  5. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

  6. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-CASPR/Neurexin IV [K65A/2R] CASPR/Neurexin IV Mouse IgG2a 206606 Anti-CASPR2 [K67/11R] CASPR2 Human...177445 Anti-CASPR/Neurexin IV [K65/35R] CASPR/Neurexin IV Rat Mouse IgG2a 177446 Anti-CASPR2 [K67/25R] ...219448 Anti-CASPR/Neurexin IV [K65A/30R] CASPR/Neurexin IV Rat Mouse IgG2a 219449 Anti-CASPR/Neurexin IV...SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin IV [K66/38R] CASPR/Neurexin IV Rat Mouse IgG2a 128626...VAPA Rat Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404...external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin IV Rat Mouse IgG1 206684...K28/77R] PSD-95 Human Mouse IgG2a 220381 Caspr [K65/31R] Caspr Rat Mouse IgG2a 220382 KChIP3 K+ channel...

  8. New Podcast Segment: Hot Plasmids

    Type
    Blog Post
    ...plasmids covered in this segment Hot Plasmid 1: CRISPR X from Michael Bassik's Lab - A new tool for making...localized point mutations. Listen to Our Segment on CRISPR X Hot Plasmid 2: Magneto 2.0 form Ali Guler's Lab...

  9. MassBioEd Career Exploration Day at Addgene

    Type
    Blog Post
    ...Architect Pam McA' Nulty (check out our blog post on CRISPR software to see the importance of programming for...Scientist Joel McDade’s presentation on the emerging CRISPR genome editing technology was a rousing success...

  10. Microbes: Look, Listen, and Tell

    Type
    Blog Post
    ...Resources on the Addgene Blog Read Our Post on CRISPR Methods for Bacterial Genome Engineering Learn ...Addgene.org Check out Our Microbiology Resource Page CRISPR plasmids designed for use in bacteria Deposit Your...

  11. COVID-19 Resources

    Type
    Collection
    ...Lab Cas12a plasmids Addgene's full CRISPR guide and summary of CRISPR pooled libraries . FlipGFP-based ...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR (Link opens in ...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...181(4):865-876.e12. (Link opens in a new window) CRISPR tools and reporters now available from Stanley ...Collection Science Journals Coronavirus Collection Springer Nature SARS-CoV-2 and COVID-19 Articles Wiley ...

  12. Three Tips to Organize Your Lab Notebooks in the New Year

    Type
    Blog Post
    ...you’re looking for. Tip 3: Share protocols and spreadsheets with lab members Now that you’ve organized your... may also want to consider moving your paper spreadsheets for reagent storage locations, such as the list...

  13. Rett Syndrome

    Type
    Collection
    ...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...

  14. Supporting Rare Disease Research with BeHeard 2017

    Type
    Blog Post
    ...proteins to monitor the localization of these genes, CRISPR to disrupt their function, and C. elegans overexpression...peritoneal mesothelioma tumorigenesis. They plan to use CRISPR and lentiviral plasmids from Addgene to knockout...

  17. Plasmids 101: Gene, enhancer, and promoter trapping

    Type
    Blog Post
    ..., they eliminate the expression of the gene (by CRISPR knockout, shRNA depletion, etc.) and ask what the...e67667. DOI: https://doi.org/10.7554/eLife.67667 Springer, S. P. Gene Traps. Plant Cell. (2000) 12(7): 1007...
Showing: 321 - 340 of 561 results