Skip to main content
Addgene
Showing: 321 - 340 of 521 results
  1. Cre-ating New Methods for Site-specific Recombination in Drosophila

    Type
    Blog Post
    ... cells, as well as in cortical neurons in layer 2/3 of the mouse brain. Rubin’s work shows that the yeast...site-specific recombination in Drosophila, read on to learn about new recombinases suitable for this system. Gerald...recombinases from the Rubin lab For more information about limitations and caveats of Cre usage: Vagaries of...
  2. Build Your CRISPR Vocabulary

    Type
    Blog Post
    ... term sgRNA. Seed sequence: The 8-10 bases on the 3’ end of an RNA guide (either crRNA or sgRNA). Cas9...used to target complementary DNA sequences. In laboratory settings, an sgRNA includes the crRNA and tracrRNA...itself, simplifying the CRISPR-Cas9 system for laboratory applications. At Addgene, we sometimes refer ...
  3. The Open Repository of CRISPR Screens: CRISPR Screen Data in One Place

    Type
    Blog Post
    ...for particular screens of interest.   Figure 3: Each publication featured in BioGRID ORCS has a dedicated...resources on the Addgene blog Read this blog post about genome-wide screening using CRISPR Find all of our...on Addgene.org Read our CRISPR guide Learn more about plasmid pooled libraries Find CRISPR plasmids for...
  4. The Blue Flame Award: Celebrating Addgene's Most Requested Depositors

    Type
    Blog Post
    ...community. These popular plasmids are categorized into a 3-level system on our website:   A yellow flame indicates...Flame awardee Sophien Kamoun of the Sainsbury Laboratory in Norwich, UK: “We’re very pleased to distribute...Plasmid in 2015 Find Hot Plasmid Technologies Write about Your Favorite Plasmid Technology Resources on Addgene.org...
  5. Optogenetics Guide

    Type
    Guide
    ...Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense is also commonly ...with single-spike temporal resolution. PLoS One. 2(3):e299. PMID 17375185 Kim B, Lin MZ. 2013. Optobiology...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User’s Guide...control of neural activity. Cold Spring Harb Protoc. 3:top102. PMID 21363959 Yizhar O, Fenno LE, Prigge M...derived from Volvox carteri. Nat Neurosci. 11(6):631-3. PMID 18432196... to permit CIB1 binding. As shown in the figure above, this light induced binding can be utilized to control...dimerization. In addition to the applications described above, both LOV and Dronpa can control activity of a fused...
  6. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' Note: If you plan to...CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other oligo),...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate ...
  7. 9 tips for a successful postdoctoral experience

    Type
    Blog Post
    ...Furthermore, Group Leader position applications require 3 letters of reference- the graduate school mentor, ...yourself to and talk with more senior scientists. 3. Work intensely, but intelligently Before you do your...Nature and Science, for example). This blog post is about how to get the most out of your postdoctoral training...your new model?  PFs need to be regularly thinking about manuscripts. The other items will follow. If you...this is a strong indicator that this person cares about your science and your development. Taken together...Researchers face a fundamental conflict. Science is about exploration, discovering new information. There ...many PFs are reluctant to give talks or posters about their research. They dread giving a departmental...
  8. Seeing Red: Simple GFP Photoconversion

    Type
    Blog Post
    ...fluorescent protein. Nat Methods. 2009 Feb 6(2):131-3.  PubMed. Find plasmids from this publication at...this protein has a few more secrets - during a collaboration, members of Maureen Hanson’s and Rima Menassa's...
  9. Addgene is Expanding Our Viral Vector Service!

    Type
    Blog Post
    ... 6–8 weeks Average shipping time: 1–2 days (USA); 3–4 days (international; varies widely by country and...educational resources.  We hope you’re as excited about this expansion as we are! Happy packaging! ...
  10. In Living Color: The Skinny on In Vivo Imaging Tools

    Type
    Blog Post
    ...fluorescent proteins. Krumholz et al (Sci Rep. 2014 Feb 3; 4:3939. doi: 10.1038/srep03939.)  ... absorbance of water, which absorbs wavelengths above 900 nm or so. In other words, wavelengths between...
  11. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...gene expression and fluorescence imaging.” Cell 159(3) (2014):635-46. PubMed PMID: 25307933. PubMed Central...Avoid Fluorescent Protein Oligomerization Learn about Small Molecule Fluorphores Resources on Addgene.org...
  12. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...Fragment Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies...molecule chaperone Skp. Front Cell Infect Microbiol 3: . https://doi.org/10.3389/fcimb.2013.00072 Additional...is referred to as an antigen. You can learn more about antibodies in our Antibodies 101 animation, What... expressing this protein. Read on to learn more about antibodies and how to use them in the lab! Parts...lots is a big concern. You can find more details about polyclonal antibodies on our Antibodies 101: Polyclonal...not necessarily what you are getting. Learn more about monoclonal antibodies here. Recombinant antibodies... as well as compare between samples. Learn more about flow cytometry. Cell and tissue labeling Antibodies...
  13. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ... research constellations: Doench/Root (2), Zhang (3), Wu (4), Yusa (5), Wang/Lander/Sabatini (6), and ...PMID: 26780180. PubMed Central PMCID: PMC4744125. 3. Sanjana, Neville E., Ophir Shalem, and Feng Zhang... to design gRNAs for all the purposes discussed above. Please see videos and text on the website for more...Output: A text file containing full information about the suggested gRNAs to use, including all information... hard to read. It´s suggested that you open the above text files, copy the content of the file, and paste...Additional Resources on the Addgene Blog Learn about CRISPR Screens How to Design Your gRNA Tips for ...CRISPR User Resources on Addgene.org Learn More About CRISPR Find CRISPR Screening Libraries Browse All...
  14. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...selection of pLKO.1 plasmid in mammalian cells. sin 3’LTR 3’ Self-inactivating long terminal repeat. f1 ori...antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3’ For example...Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids B. Designing shRNA Oligos for pLKO... C.1 Recommended materials C.2 Annealing oligos C.3 Digesting pLKO.1 TRC-Cloning Vector C.4 Ligating and...Determining the optimal puromycin concentration F.3 Protocol for lentiviral infection and selection G....Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty information Back to Top A. pLKO.1-TRC Cloning...long terminal repeat. RRE Rev response element. A.3 Related Products The following plasmids available ...
  15. 10 Ways to Share Your Science!

    Type
    Blog Post
    ...practicing scientists. 3)   Consider starting up your own twitter feed or talking about and sharing some science...take on collaborative roles in academia, and that means it’s important to know how to talk about science...important for scientists to get out there and talk about their work. To tell others why that work is cool... than ever before for scientists to communicate about their work and their interest in science more generally...already make it a habit to talk – really talk – about the research you are doing in the lab with your ... the details of your science but also something about how science really works. 2)   Read science writing... told. Twitter can be a good way to follow news about particular subjects or find out what others are ...
  16. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...while AAV-PHP.S is typically used at a dose between 3 x 1011 and 1 x 1012 vg*. Most systemic capsids are...transduction in New World monkeys   Figure 3: Evolutionary tree depicting the phylogenetic relationship...414 (2019). https://doi.org/10.1038/s41596-018-0097-3 More resources on the Addgene blog Viral Vectors 101...Sensory Ganglion Neurons Using AAV-PHP.S. eNeuro,9(3), ENEURO.0373-21.2022. https://doi.org/10.1523/ENEURO...Are Limited to C57BL/6J Mice. Molecular Therapy, 26(3), 664–668. https://doi.org/10.1016/j.ymthe.2018.01.018... for their use. Then, we’ll provide information about commonly used and emerging capsids to help you decide...our Caltech Systemic Capsids page to learn more about that collection. Table 1: Systemic capsid plasmids...
  17. Addgene's a Nonprofit? Nonprofit Awareness Day 2017

    Type
    Blog Post
    ...under the United States Internal Revenue Code 501(c)(3). That means we were formed to benefit the public,...Additional Resources on the Addgene Blog Learn about Our Collaboration with Fellow Nonprofit Seeding Labs Addgene...the American Cancer Society, or maybe you think about a local food pantry or community arts organization...community Addgene fosters a culture of respect, collaboration, and fun Addgene believes there is strength ...accelerate research with easier sharing and collaboration. Joanne and all the Addgenies: Adam, Amanda ...Connie Cepko Resources on Addgene.org Learn More About Our Mission Meet the Addgene Leadership Team Get...
  18. Extracurricular Activities for a Strong Science Career Path

    Type
    Blog Post
    ...sets Taking the time to identify and research 2 – 3 potential professions will highlight which skills ...This great resource allows the undecided to learn about a variety of science professions based on their ...training focuses on using multidisciplinary, collaborative, and translational approaches for scientific...skills. Although the word “extracurricular” may be taboo in the lab, multiple research studies highlight ...social media (Twitter, Facebook, etc.) to learn about available jobs, fields, and trends “Never Leave...from your lab bench.  Want further information about shaping your career to your values, interests, and...Let us know what topic you'd like to learn more about next. Leave your suggestions in the comments section...
  19. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

    Type
    Blog Post
    ...yellow fluorescent protein at the time. It is 1.5 to 3 times brighter than the most commonly used GFPs and...We are excited about our new partnership with Allele Biotechnology which allows researchers to deposit...blue-shifted compared to its parent protein CFP484. Collaborating with scientists from Florida State University...mWasabi plasmids here! One of the most notable things about these proteins is that they are monomeric fluorescent... fluorescent protein blog posts Find blog posts about choosing fluorescent proteins for your research ...the Addgene blog Resources on Addgene.org Learn about the Michael Davidson fluorescent protein collection...
  20. Addgene Begins Distribution of Recombinant Antibodies

    Type
    Blog Post
    ...and Transparency of Experimental Methods. Neuron 90(3):434-6. https://doi.org/10.1016/j.neuron.2016.04.030... also be collecting feedback from the community about how the antibodies work in various applications,...antibodies are plasmid-based and recombinant. Learn more about recombinant antibodies here. Finally, Addgene is...against PSD-95 from the Trimmer Lab. Information about the antibody, the target antigen, and performance...blog and Antibody Guide, which include information about immunofluorescence, conjugates, isotypes, and more...learn more or get started.  If you have suggestions about how to make the resource better or ideas for new...
Showing: 321 - 340 of 521 results