Skip to main content
Addgene

We narrowed to 1,019 results for: ren

Showing: 361 - 380 of 1019 results
  1. Genome-wide Screening Using CRISPR

    Type
    Blog Post
    ... are composed of many different gRNA-containing plasmids, each with a different genomic target. The goal...1.  What species are your cells derived from? Currently, Addgene carries CRISPR libraries that target ...genome, or a specific class of genes? Addgene currently carries several genome-wide CRISPR libraries and...cell or set of cells containing a mutation in a different gene. Libraries may be available in a 1-plasmid...multiple replicates and several cell types can strengthen your results. Enrichment or depletion of multiple... out our CRISPR Plasmids and Resources Page. References McDade JR, Waxmonsky NC, Swanson LE, Fan M (2016... for Using Pooled Lentiviral CRISPR Libraries. Current Protocols in Molecular Biology 115: . https://doi.org...
  2. Transferable Skills Guide: Identifying Your Transferable Skills

    Type
    Blog Post
    ...social life and rest. I need it just as much in my current role as Customer Support and Operations Manager...and projects. It is crucial to identify these strengths within yourself, and to demonstrate them to the...collaboration and fail to identify it as a personal strength until it is identified by another person. Similar...situations where you can learn more about possible strengths and weaknesses, and view everything as a learning...naturally to you. How is this new opportunity much different? Might you already have leadership skills that...solution to the person over email. Examine your current and past job descriptions. Scan through all the...piece of paper and list all the skills that your current or past job requires day-to-day, and you’ll get...
  3. Getting to Know Expansion Microscopy

    Type
    Blog Post
    ...the integrity of different targets and labels. You may want to check out a few different protocols to look...you’ve been looking for too!     References and resources References Bertiaux E, Balestra AC, Bournonville... two points within ~250 nm of each other. For reference, individual presynaptic terminals, which are jam...optically magnify quite so much. Created with biorender.com Steps 2-4 are not found in standard IHC/ICC...traditional full IgG secondaries, can improve signal strength (Sherry and Stiles, 2022). Fourth, signal continuity...2020). Plus, it’s been demonstrated to work in different model systems, paired with SRM techniques, and...
  4. Plasmids 101: Colony PCR

    Type
    Blog Post
    ...created with the same backbone but that contain different inserts. When you design primers to anneal outside...primer pair to screen for the presence of many different inserts. The downside: this type of primer does... The type of primers you use depends on your preferences. Either way, make sure to test your colony PCR...a standard PCR thermocycling program. One key difference is the plasmid DNA must be released from the ...and without an insert. These controls are quick references you can use when you run your PCR products out... an appropriate molecular weight standard for reference and to add a loading dye with glycerol to your...products have any mutations.  There are lots of different cloning strategies, but regardless of which is...
  5. Twenty Years of Sharing: Expanding Accessibility

    Type
    Blog Post
    ..., many plasmids were available, but they often weren’t easily accessible, due to a wide range of logistical...world. This idea, that available and accessible weren’t always the same thing, shaped both Addgene’s founding...distributor for that country. In China, direct shipments weren’t able to clear import control. Partnering with a...form of problem-solving. When universal solutions aren’t enough to ensure accessibility, partnering with...particular topic into beautifully designed and easy-to-reference eBooks. Figure 3: Global readership of the Addgene...which received over two million views from 119 different countries (Figure 4). Four of the five most popular...researchers who use them. The best part of any conference is scientists, from techs to grad students to...
  6. Getting the Most from Your Lentiviral Transduction

    Type
    Blog Post
    ...be translated to other lines. Differences in the physiology of different cell types, however, can make...not only between serum from different manufacturers but also between different lots of serum from the same...concentrated dilutions you will be able to overcome differences in receptor expression. It's all in the mix Even...typically employ the positively charged polycation, polybrene. Interestingly, one study found that alternative...Virus? Check out Addgene's New Viral Service! References 1. Hay, R.J., Macy, M.L. & Chen, T.R. “Mycoplasma...tropism of lentiviral vectors through pseudotyping.” Current Gene Therapy 5.4 (2005). 387-98. Pubmed PMID: 16101513...
  7. IBEX Knowledge-Base: A Data Resource for Multiplex Tissue Imaging

    Type
    Blog Post
    ...shared ownership. Go check it out! References and Resources References Radtke, A. J., Chu, C. J., Yaniv,...mean highly multiplexed: you can image over 65 different parameters using this method (see Movie S8 from...for spatial biology enthusiasts. This dataset currently includes 1049 community-validated reagents from...fluorescent probes, representing imaging from 47 different tissues. Researchers upload and share both their...resources .csv file for easy filtering and sorting. Reference images can be viewed by clicking on the links ...data, more discussion, and more functionality. Transparency, both in what works and in what doesn’t, and...
  8. Promoters

    Type
    Guide
    ... Plasmid Reference Molecular Biology Reference Promoters Promoters Definition A promoter is...Addgene's molecular biology reference material covering promoters, transcription and the transcription...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Operons Although bacterial...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter... types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes encoding...
  9. Deep Mutational Scanning with One Pot Saturation Mutagenesis

    Type
    Blog Post
    ...works well to generate libraries, they all have inherent shortcomings compared to one pot saturation mutagenesis... and scalability (see Supplementary Table 1 of Wrenbeck et al). It uses a uracil labeled wild-type ssDNA... saturation mutagenesis technique described in Wrenbeck et al is a PCR-based approach for generating a...264 basepairs, was the maximum length tested by Wrenbeck et al but it’s likely that longer stretches of...of positive clones. See Supplementary Note 1 in Wrenbeck et al for details on how nicking was optimized...mutagenesis? How would you use it in your research? References 1. Natarajan, Chandrasekhar, et al. "Epistasis...Protocols, pg. 103-109. PubMed PMID: 20676978. 3. Wrenbeck, Emily E., Justin R. Klesmith, James A. Stapleton...
  10. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...construct containing fluorescent proteins (XFP) of different colors to label an organ or entire organism. Because...localization sequence, allowing it to localize to a different area of the cell than CFP and YFP. The most recent...could recombine to activate the expression of a different fluorescent protein. Therefore, each cell could...Confetti mouse was first used to describe the self-renewal of cells in the intestinal crypt, and since then...proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018) overcame...method that makes tissues, such as the brain, transparent so that the 3D architecture of a fluorescent ...can be combined with new imaging techniques.  References Cai, Dawen, et al. "Improved tools for the Brainbow...
  11. New Optogenetic Tools for Cytoskeleton and Membrane Control

    Type
    Blog Post
    ...of interest supports a variety of processes in different cell types. One great way to do this is to use...model for optogenetic studies since they are transparent and the developing embryo is accessible for injection...SuperPLD module is optogenetically recruited by different CIB constructs to the plasma membrane or lysosomes...future updates to the collection! Resources and references Additional resources on the Addgene blog Viral....org Optogenetics Guide Optogenetics Plasmids References Aljiboury, A. A., Ingram, E., Krishnan, N., Ononiwu...precise control over vascular endothelial barrier strength. eLife, 12, RP84364. https://doi.org/10.7554/eLife...optogenetic tool for localized, microtubule disassembly. Current Biology, 32(21), 4660-4674.e6. https://doi.org/...
  12. Using Phosphoserine to Study Protein Phosphorylation

    Type
    Blog Post
    ...however different proteins will likely achieve different levels of incorporation due to differences in stability... further technical reference and protocols for use of this system, please reference ‘Rinehart Lab reagents...tools such as phosphospecific antibodies, which aren’t available for the majority of documented phosphorylation... length of induction, which will vary between different proteins. Beyond these standard considerations...mitochondrion. You can follow her on Twitter @nieminm.   References 1. Cohen, Philip. "The origins of protein phosphorylation...
  13. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...hard to count the number of different commercial strains of E. coli currently available – a quick Google...the intestinal tract of animals. There are many different naturally occurring strains of E. coli, some of...more convoluted due to researchers sharing and renaming samples throughout history. It was likely isolated...tetracycline Additionally, Table 2 provides a quick reference for some of the popular strains, their genotypes...lacZΔM15] hsdR17(rK-mK+)  MC1061 Streptomycin Parent of DH10B/TOP10 and derived strains, common lab ... has a great list of genetic markers for your reference. Browse Addgene's curated list of Bacterial Expression... Matthew Ferenc...
  14. Early Career Researcher Toolbox: Free Tools for Making Scientific Graphics

    Type
    Blog Post
    ... to use pre-drawn images in your figures Biorender Biorender is like clip art for scientists. The web-...guarantee Biorender will create it. Additionally, you can upload your own images to the Biorender workspace...workspace. Free Biorender accounts can store 5 workspaces at a time and workspaces are only downloadable in...in a small file size with a Biorender watermark, which is usually ok for informal settings like lab meeting... paid account.  I’m proud to announce that @BioRender (a project my team & I have poured our hearts ...
  15. Antibodies 101: Fc Effector Functions

    Type
    Blog Post
    ...subclass, and are part of the reason why different isotypes drive different types of immune responses. Handily... do so much more than that!    References and resources References Clynes RA, Towers TL, Presta LG, ...immune cells. (psst! Need a quick review of the different immune responses? We got you! You can also review...receptors; and so on and so forth. There are a lot of different receptors, but their downstream effects can be...region contributes to affinity and specificity. Trends in Immunology, 29(2), 91–97. https://doi.org/10.1016...
  16. Networking and Inspiring Young Scientists at Freshers Fairs

    Type
    Blog Post
    ...Laureates, who speak about their work and current, trending topics in their area of research. The society...students with their applications. The society currently has 1,283 members, who comprise undergraduates...students who want to study chemistry. The society currently has 352 members, ranging from undergrad all the...Biological Society based at the University of Oxford currently has around 700 members and hosts a range of scientific...provides talks and career support for a range of different scientific disciplines, as well as social and ...members as well as arranging collaborations and conferences for their students. Another large goal of the...
  17. Sequencing Primers

    Type
    Guide
    ... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...
  18. Is this the right place for me? 8 tactics for choosing a lab

    Type
    Blog Post
    ...something you CAN choose and it will make a huge difference for your future career and life. You might see...amazing scientists, but the labs were profoundly different. My first rotation was with a mid-sized lab with...hone in on the factors that will make the most difference for your success. Gather data on the lab choices...? What is the energy level in the lab? Does a frenetic atmosphere make you edgy or energized?   Are you...used to a lot of attention? Or are you one of 8 children and used to getting the attention you need? Are...your best performance and learning? Everyone’s different so give some thought to what atmosphere makes ...lifelong learners. I believe we won’t be happy if we aren’t learning so before you take any position you must...
  19. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ...plasmid sample has a mix of different-sized multimers, you may even see different sets of bands on the gel... us at [email protected]. Resources and References References Bacolla A, Wang G, Jain A, Chuzhanova NA...multimerization has been observed to occur in many different kinds of plasmids, taking many forms (Levene, ...from BiteSize Bio for more information on how different plasmid conformations run on an agarose gel). ... tips. Portions of this figure were made with BioRender.   Grow plasmids in recombinase-deficient...Plasmids 101 eBookAddgene's Molecular Biology ReferenceAddgene's Restriction Digest Protocol More resources...
  20. FPbase: A new community-editable fluorescent protein database

    Type
    Blog Post
    ...view previous versions.  Currently, all submissions also require a DOI referencing primary literature, and...the time) began an effort to collate some of the current “best” FPs, and I collaborated with him on a web-based...that one might like to store about FPs than is currently represented at fpvis (complete spectral information...sequences and lineages, FRET efficiencies, additional references, etc...) and a more robust database structure...address).  One may also simply attach important references that serve to further characterize a protein ...plenty of room for improvement and elaboration.  Current projects include incorporation of biosensors, protein...
Showing: 361 - 380 of 1019 results