... Jake Watson and Javier García-Nafría from the MRC Laboratory of Molecular Biology. Jake Watson is a postdoctoral...This post was contributed by Jake Watson and Javier García-Nafría from the MRC Laboratory of Molecular...receptor function.     Follow them on Twitter @jakefwatson and @JGarciaNafria.  References 1. Jones, Douglas...PMCID: PMC331480. 3. García-Nafría, Javier, Jake F. Watson, and Ingo H. Greger. "IVA cloning: a single-tube...

...CRISPR libraries from Addgene are available in two formats: as liquid DNA, or in select cases, as pre-made...A., Benincore-Flórez, E., Karunathilaka, A., & Tomatsu, S. (2024). Current strategies for increasing Knock-In...

... the Tet Response Element (TRE) A TRE is seven repeats of a 19 nucleotide tetracycline operator (tetO)...

...be found associated with the following article: Natsume, et al. Cell Reports 2016 Förstemann Drosophila...

...recapitulate Rett syndrome in humans. MECP2 knockout rats are available from (Link opens in a new window) ...

...cells by heatshock with the plasmid of interest. See our transformation page for a detailed heatshock transformation...

...introns. Avoid stretches of 4 or more nucleotide repeats, especially repeated Ts because polyT is a termination...an ampicillin analog). Due to the long terminal repeats found in lentiviral plasmids, Addgene currently...or NEB Stable cells. This will ensure that the repeats will be maintained and often results in a greater...

...Disinfectant Thermometer Water bath weights and floats Reagents None needed Procedure Ensure that the ...water bath when they are placed inside. Water bath floats can be used to secure tubes in place and water ...

...issue of proprietary data formats. Many instruments store raw data in formats that require specific (expensive...software that evolves over time such that prior formats are no longer supported/readable. Is the author...their host institution expected to provide data in formats exported to common file types? And how long should...

...for a ligase? DNA ligases generally prefer fully Watson-Crick base-paired dsDNA substrates to those containing... base-pair size nearly indistinguishable from a Watson-Crick base pair, are joined with nearly the same...allowed screening of all possible base combinations (Watson-Crick and mismatched) around the ligation junction... (2013): 1415-1422. PubMed PMID: 23463388. 18. Hommatsu, Manami, et al. "Development of a PCR/LDR/flow-through...

...Clustered Regularly Interspaced Short Palindromic Repeats. That contrast of simplicity and complexity is ... of these arrays, with alternating spacers and repeats, was the original impetus for studying CRISPR. ...array, these sequences are called protospacers. Repeats: Bacterial DNA that appears between each spacer...

... et al used four oligos that consist of direct repeats and crRNA.  Similar to a jigsaw puzzle, the oligos... reverse the orientation of the crRNA’s direct repeats when expressing the Cpf1 multiplex system from ...This undoes the original reversing of the direct repeats, leading to expression of a crRNA array that can...

...This MazF-ZeoR cassette is flanked by two direct repeats which can be used for marker removal so that the...second recombination event between the two flanking repeats. In cells where recombination has not occured, ...8650219. PubMed Central PMCID: PMC39188. Kamada, Katsuhiko, Fumio Hanaoka, and Stephen K. Burley. "Crystal...

...types of Class 1 TEs: those with long terminal repeats (LTRs) and those without (non-LTR TEs). LTR retrotransposons...transposase enzyme binds the transposon’s long terminal repeats (LTRs), induces a double-stranded break, and excises...generate transgenic animals, including zebrafish, mice, rats, and rabbits (Sandoval-Villegas et al., 2021).  ...

...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221...

...currently at 4,651 as of April 8, 2021) Find these stats and more on the addgene.org homepage! You can track...of plasmids right below the search bar and more stats further down the page....

...season snow flurries, dusting off the winter coats and hats, and our annual Deck The Lab holiday decorating...

... community (check out the infographic below for stats on our plasmid deposits and requests). Over the ...on social media or around the office. @Addgene congrats for 1 million orders. @RothLabUNC accounts for...

...summer months, but this is also our best month ever! Hats off to all of our wonderful writers and all those...Libraries Available: Pooled and Individual Plasmid Formats Better Dyeing Through Chemistry & Small Molecule...

...transposon consists of a mirrored set of inverted repeats (green) flanking the gene of interest (blue) in...is expressed (red stars) and binds the inverted repeats (green); and an endonuclease reaction occurs which...