Skip to main content
Addgene
Showing: 1 - 17 of 17 results

  1. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide linker standard consisting of...of ECFP and EYFP connected by 3 GGSGGS repeats pET28CLY4 Peptide linker standard consisting of ECFP and...and EYFP connected by 4 GGSGGS repeats pET28CLY5 Peptide linker standard consisting of ECFP and EYFP connected... connected by 5 GGSGGS repeats pET28CLY6 Peptide linker standard consisting of ECFP and EYFP connected...connected by 6 GGSGGS repeats pET28CLY7 Peptide linker standard consisting of ECFP and EYFP connected by 7 GGSGGS...GGSGGS repeats pET28CLY8 Peptide linker standard consisting of ECFP and EYFP connected by 8 GGSGGS repeats...consisting of ECFP and EYFP connected by 9 GGSGGS repeats pmVenus(L68V)-mTurquoise2 Brightness standard used...

  2. TALEN Guide

    Type
    Collection
    ... domain is composed of 33-35 amino acid repeats. These repeats only differ from each other by two amino... of 18 TAL effector repeats. The kit can be used to make arrays from 12-31 repeats. Perhaps one of the...from Addgene , custom arrays consisting of 12-31 repeats can be assembled and inserted into a variety of...

  3. TALEN Plasmids and Kits

    Type
    Collection
    ... customizable arrays of polymorphic amino acid repeats in the TAL effectors. View Addgene's TALEN Guide...Plasmid 47389 also contains the VP64 domain (four repeats of the minimal activation domain of VP16) at the...cell expression, and encode one of three 0.5 TALE repeats (C, T, and G) and the full length human LSD1 at...

  4. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system may be...s protospacer sequence and PAM fall on the top (Watson) strand ( Figure 2A ). However, DSB will occur ...by clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 in mammalian cells. Canver...

  5. Zhang Lab CRISPR Page

    Type
    Collection
    ...lustered R egularly I nterspaced S hort P alindromic R epeats) is a microbial nuclease system involved in defense...knockout screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9...efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid...

  6. Caltech Systemic Capsids

    Type
    Collection
    ... mouse strains. **AAV1-X1 has not been tested in rats. Abbreviations: AAV, adeno-associated virus; GRE...AAV.CAP-B10 Brain vascular cells - AAV.CAP-Mac For rats: Broad tropism - AAV-PHP.eB Cell type-biased: Neurons...

  7. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC102867 SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain ... semF SEMA5B sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain ...

  8. TALEN Engineering

    Type
    Collection
    ...Zebrafish ( Sander et al., Nat Biotechnol. 2011 ) Rats ( Tesson et al., Nat Biotechnol. 2011 ) Human somatic...

  9. Qi Lab CRISPR Page

    Type
    Collection
    ...lustered R egularly I nterspaced S hort P alindromic R epeats) pathway, as an RNA-guided DNA binding platform...

  11. CRISPR Guide

    Type
    Collection
    ...CRISPR libraries from Addgene are available in two formats: as liquid DNA, or in select cases, as pre-made...A., Benincore-Flórez, E., Karunathilaka, A., & Tomatsu, S. (2024). Current strategies for increasing Knock-In...

  13. CRISPR Plasmids - Tagging

    Type
    Collection
    ...be found associated with the following article: Natsume, et al. Cell Reports 2016 Förstemann Drosophila...

  14. Rett Syndrome

    Type
    Collection
    ...recapitulate Rett syndrome in humans. MECP2 knockout rats are available from (Link opens in a new window) ...

  15. Validated gRNA Sequences

    Type
    Collection
    ...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221...

  16. Cre-lox system

    Type
    Collection
    ... Natl Acad Sci. Jul 15;89(14):6232-6. PubMed . Matsuda T, Cepko CL. 2007. Controlled Expression of Transgenes...
Showing: 1 - 17 of 17 results