We narrowed to 24 results for: Aspa
-
TypeGuide...Arg R CGU, CGC, CGA, CGG, AGA, AGG Asparagine Asn N AAU, AAC Aspartic acid Asp D GAU, GAC Cysteine Cys ...
-
Immunology Research Plasmids and Resources
TypeCollection...IMD1, MGC126261, MGC126262, PSCTK1, XLA CARD11 caspase recruitment domain family, member 11 BIMP3, CARMA1...BRAF1, FLJ95109, MGC126806, MGC138284, RAFB1 CASP3 caspase 3, apoptosis-related cysteine peptidase CPP32, ...lymphoma 10 CARMEN, CIPER, CLAP, c-E10, mE10 CARD11 caspase recruitment domain family, member 11 BIMP3, CARMA1... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression pnCasPA-BEC - A cytidine deaminase-mediated base-editing... -
Validated gRNA Sequences
TypeCollection...GCTCTGCTGGGAAGCGAATC 75163 cut S. pyogenes 27194728 Bornhauser Caspase-8 H. sapiens GCCTGGACTACATTCCGCAA 75164 cut S. ...