Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 107 results for: EGF

Showing: 21 - 40 of 107 results

  1. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

    Type
    Blog Post
    ... to LanYFP and the addition of the enhanced GFP (EGFP)-type termini. mNeonGreen was reported as the brightest...protein. In vitro, mWasabi is 1.6-fold brighter than EGFP and is photostable. It also has narrow excitation...it does not significantly excite at 400 nm while EGFP does. Find mWasabi plasmids here! One of the most...

  2. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...IRES EGFP Chimeric channels for neuronal manipulation 119742  AAV5  AAV SYN PSAM4 GlyR IRES EGFP Chimeric...*  pAAV-CAG-GFP 50465  AAV8*, AAV9*  pAAV-hSyn-EGFP *Also coming in our new 20 ul trial size! Voltage...

  3. Choosing Your Fluorescent Proteins for Multi-Color Imaging

    Type
    Blog Post
    ...proteins for imaging with this set are mTagBFP2, EGFP or one of the improved GFP variants, mRuby2 or TagRFP-T...mammalian cells, one of the improved folding variants of EGFP like mEmerald or Clover is probably best; mNeonGreen...and have reported brightness measurements. Here, EGFP outperforms the improved folding variants, presumably...

  4. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon Harvey 50457 AAV2 pAAV-hSyn-DIO-EGFP Bryan Roth 50459 AAV1 pAAV-hSyn-DIO-mCherry...pAAV-hSyn-DIO-mCherry Bryan Roth 50457 AAV1 pAAV-hSyn-DIO-EGFP Bryan Roth 114472 AAVrg pAAV-hSyn-mCherry Karl...

  5. New Tool for Lineage Tracing: The ClonTracer Library

    Type
    Blog Post
    ...receptor (EGFR) with the ClonTracer library and monitored population dynamics after treatment with EGFR inhibitor... in a study focusing on tumor cell resistance to EGFR inhibitor (Hata et al., 2016).  Bhang deposited ...

  6. Sequencing Primers

    Type
    Guide
    ...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

  7. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...Category Depositor  Notes pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics Yizhar...service with multiple serotypes pAAV_hSyn-PdCO-EGFP-WPRE AAV1, AAV5 Optogenetics Yizhar New viral service...

  9. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    .... Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin...destination vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...be conveniently performed through the N-terminal eGFP tag carried on all constructs.   pXPG: An alternative...

  10. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ... Controls Edward Boyden New serotype pAAV-hSyn-EGFP AAV PHP.eB Controls Bryan Roth New serotype AiP13044...Controls Jonathan Ting New viral prep pAAV-CaMKIIa-EGFP AAV1 Controls Bryan Roth New serotype pAAV-Ef1a-DIO...

  12. Hot Plasmids - January 2023

    Type
    Blog Post
    ...caused by T cell migration.  CAR expression (or the eGFP proxy for CAR) is elevated at stable levels for ...      Fig. 2: Addgene’s western blot for mEGFP-HRas (from Plasmid 18662). See the Applications ...

  14. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...their 3 Opto-RTK constructs – Opto-mFGFR1, Opto-hEGFR, and Opto-hRET – as well as various LOV-domain-mVenus...

  15. Hot Plasmids - February 2022

    Type
    Blog Post
    ...This set of new anti-FLAG frankebodies includes mEGFP, mRuby2, iRFP713, SNAP-tag, and HaloTag fusions,...fusions, while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG...

  20. Hot Plasmids - August 2020

    Type
    Blog Post
    ...pMAK463 (NBαMouse-IgK, Addgene #140701) pMAK464 (NBαEGFP, Addgene #140702) The pMAK461-64 plasmids were...introduced into the hPSC genome using AAV1 and contain an EGFP reporter. Expression of the dCas9-KRAB activator...
Showing: 21 - 40 of 107 results