We narrowed to 41 results for: EGF
-
TypeCollection...TACATCAGCAGCGTGGTGtcgtgtgtggtgttccTGCTCGGCATGCTGGGAA egf-like-domain TAL3064 & TAL3065 TTGGTGATGTCTGGAGTCgtcgcgtgtcttacagCACAGAGTCTTTTCTTCA...TGACTGGGAGGAAGATCAgagtcccgttgtgtctTGCAGCTCAGGATTTGGA Vascular-endothelial growth-factor-aa (vegfaa) TAL3200 & TAL3201 TCTCGCTTTGCTTCCTCCtcagtgattcccttcaTGGATGTGTATAAAAAGA...
-
The Pleiades Promoter Project
TypeCollection...pEMS1086 EGFP/cre/NLS Ple106 HAP1 pEMS1370 EGFP/NLS Ple107 HBEGF pEMS1252 EGFP/NLS Ple108 HBEGF pEMS1253 EGFP... EGFP/NLS Ple109 HBEGF pEMS1254 EGFP/NLS Ple109 HBEGF pEMS1580 intron-lacZ/NLS Ple110 HBEGF pEMS1255 EGFP... pEMS1301 cre/EGFP/NLS N/A pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS N/A pEMS1306 EGFP/NLS N/A pEMS1307...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin...109120 GJA1-mEGFP AICSDP-43 mEGFP Connexin-43 Gap junctions 109121 HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Gadella 58473 pEGFP-C1 F-tractin-EGFP Actin Filaments F-tractin EGFP Dyche Mullins 41147 pEGFP Centrin2 Centrioles... LC3 EGFP Tamotsu Yoshimori 21073 pEGFP-LC3 Autophagosome LC3 EGFP Tamotsu Yoshimori 24920 pEGFP-LC3 (...Cortactin EGFP Anna Huttenlocher 32907 pEGFP-rNFM Intermediate Filaments (neuronal) Nefm EGFP Anthony Brown...Brown 32909 pEGFP-mNFM Intermediate Filaments (neuronal) Nefm EGFP Anthony Brown 11908 pEGFP-N1 alpha-actinin...Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP Erich...mTurquoise2 Dorus Gadella 26673 pEGFP-C1-Fibrillarin Nucleolus Fibrillarin EGFP Sui Huang 36207 pmTurquoise2...Chromatin H2B GFP Geoff Wahl 21210 PGK-H2BeGFP Chromatin H2B EGFP Mark Mercola 21217 PGK-H2BmCherry Chromatin... -
Neurodegeneration Plasmid Collection
TypeCollection...pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1...14121 pcDNA3-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP...Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H)-EGFP VCP His, GFP, HA CMV...Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV...Merrifield 28195 tdp43-EGFP construct2 TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP...Zuoshang Xu 28197 tdp43-EGFP construct4 TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP...Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP... -
Control AAV Preps
TypeCollection...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG CamKII EGFP Constitutive 1, 5 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP Constitutive...-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331 pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent...pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, 11, rg*, PHP.eB Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa... PHP.eB Gradinaru 100896 pAAV.GFA104.PI.eGFP.WPRE.bGH GFA104 EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP...Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10,...Constitutive 8 Wilson 105542 pENN.AAV.CB7.CI.eGFP.WPRE.rBG CB7 EGFP Constitutive 1, 2, 5, 8, 9 Wilson 105543...105543 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG cTNT EGFP Constitutive 9 Wilson 105544 pENN.AAV.CB7.CI.mCherry.WPRE.RBG... -
Penn Vector Core Partnership with Addgene
TypeCollection...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James M. Wilson AV-1-PV1963 105542-AAV1 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control... pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH Control James...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James M. Wilson AV-5-PV1963 105542-AAV5 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control....GFA104.PI.eGFP.WPRE.bGH Control Philip Haydon AV-5-PV2407 105549-AAV5 pAAV.GFAP.eGFP.WPRE.hGH Control... pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 105530-AAV9 pAAV.CMV.PI.EGFP.WPRE.bGH Control James...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James M. Wilson AV-9-PV1963 105542-AAV9 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control...105539-AAV1 pAAV.hSyn.eGFP.WPRE.bGH James M. Wilson AV-9-PV1696 105539-AAV9 pAAV.hSyn.eGFP.WPRE.bGH James M... -
Cre-lox system
TypeCollection...EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion...105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40... Mammalian Sauer 11956 pBS594 promoterless EGFPcre Cre-EGFP fusion in a promoterless vector with several...none Mammalian Sauer 11957 pBS595 tet-hCMV-EGFPcre Cre-EGFP fusion Tet inducible Mammalian Sauer 11958...sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR Cre, KASH-tagged EGFP, and sgRNA expression hSyn...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer ...pCL20c-MSCV-IRES-CRE Cre MSCV Mammalian Roussel 86805 pLV-EGFP-Cre EGFP-Cre fusion CMV Lentiviral Lasek 87682 AAV-U6gRNA1... -
Retrograde AAV viral preps
TypeCollection...AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Zeng 50465 pAAV-hSyn-EGFP Syn EGFP Control Roth...Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Roth 114472 pAAV-hSyn-mCherry Syn mCherry Control Deisseroth...tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP Syn EGFP, Cre-dependent Control Roth 55650 pAAV-hSyn ...Syn EYFP Control Gradinaru 105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control Wilson 24593 AAV-pgk-Cre...Recombinases Deisseroth 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases...Activator DREADD Fishell 98747 pAAV-FLEX-EGFPL10a EF1a EGFPL10a, Cre-dependent Molecular Tool Heintz , ...Gradinaru 112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a Color-flipping switch. Expresses NLS-mCherry... -
Validated gRNA Sequences
TypeCollection...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24424410 Ye VEGF H. sapiens GACCCCCTCCACCCCGCCTC 47506 cut S. pyogenes 23792628 Joung VEGF H. sapiens ... -
Caltech Systemic Capsids
TypeCollection...Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKIIa EGFP Control Roth 59462...105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson 105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control...Fishell Recombinases 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn Cre-EGFP expression Cre Wilson 105550... 214852 AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) minBG Activator CoChR... 214853 AiP14035: pAAV-AiE0452h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4035) minBG Activator CoChR... 214869 AiP15140: pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140) minBG Activator CoChR... -
Lentivirus Plasmids
TypeCollection...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...puro resistance Sabatini 14883 FUGW 3rd hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247...3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression...added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression... -
Brain Initiative Collection
TypeCollection...198513-AAV1 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under control of human synapsin1...198513-AAV5 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under control of human synapsin1...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Expresses bicistronically soma-targeted ChrimsonR in frame with EGFP and the...Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA helper virus for monosynaptic tracing; to be...tracing; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA Ian Wickersham 104052-AAVPHP.V1 pAAV-CAG-DIO-EYFP...Edward Boyden 108422-AAV5 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 AAV production plasmid encoding for Archon1 ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence... Gen) 48140 Mammalian BbsI yes, nick S. pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, ...3rd Gen) 48138 Mammalian BbsI yes, cut S. pyogenes EGFP Zhang PX335 (2nd Gen) 42335 Mammalian BbsI yes, ... Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Bacterial Expression mEGFP 488 507 34 6 Monomer (A206K) pmEGFP-1 - Mammalian Expression mEGFP-N1 - Mammalian...mEmerald-pBAD - Bacterial Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP...Expression pLV-eGFP - Mammalian Lentiviral Expression Ac5-STABLE1-neo - Insect Expression pCS2+8CeGFP - Zebrafish...urchin pCS2+8NeGFP - Zebrafish/Xenopus/C.elegans/Sea urchin pKT0128 - Yeast Expression EGFP-pBAD - Bacterial...Mammalian Expression mEGFP-C1 - Mammalian Expression mEGFP-pBAD - Bacterial Expression mAzamiGreen 492 505 41...includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95_75 - C-terminal GFP for C. elegans expression... -
Immunology Research Plasmids and Resources
TypeCollection...LEAP-1, LEAP1, PLTR HBEGF heparin-binding EGF-like growth factor DTR, DTS, DTSF, HEGFL HDGF hepatoma-derived..., ETRB, HSCR, HSCR2 EGF epidermal growth factor (beta-urogastrone) HOMG4, URG EGFR epidermal growth factor...TIE1 tyrosine kinase with immunoglobulin-like and EGF-like domains 1 JTK14, TIE TNC tenascin C HXB, MGC167029...receptor NR1I1 VEGFA vascular endothelial growth factor A MGC70609, MVCD1, VEGF, VEGF-A, VPF VEGFB vascular ...factor (vascular endothelial growth factor D) VEGF-D, VEGFD FIGNL2 fidgetin-like 2 - FLT1 fms-related tyrosine... III receptor tyrosine kinase) CD309, FLK1, VEGFR, VEGFR2 KGFLP1 keratinocyte growth factor-like protein...DKFZp781F1414, NP1, NRP, VEGF165R NRP2 neuropilin 2 MGC126574, NP2, NPN2, PRO2714, VEGF165R2 NRTN neurturin NTN... -
Arf GTPase Family
TypeCollection...EFA6) 5662 1024 Mammalian (pEGFP-C1) GEF Psd2 (EFA6C) 84249 771 Mammalian (pEGFP-C1), Gateway GEF Psd3 (EFA6D...GTPase Arl1 400 181 Bacterial (pET), Mammalian (pEGFP-N3) Gateway GTPase Arl2 402 184 Bacterial (pET),...116984 1704 GAP Arap3 (CENTD3) 64411 1544 Mammalian (pEGFP-C2) GAP Acap1 (CENTB1) 9744 740 Mammalian (pFLAG-CMV2...Bacterial (pET) GAP Git1 28964 770 Mammalian (pcDNA3, pEGFP) GAP Git2 (PKL, CAT2) 9815 759 GAP ELMOD1 55531 ...GAP RP2 6102 350 Bacterial (pGEX4T), Mammalian (pEGFP-N3), Gateway GEF Arfgef1 (BIG1, ARFGEP1) 10565 1849...398 Gateway GEF Cyth2 (ARNO) 9266 400 Mammalian (pEGFP-C1), Gateway GEF Cyth3 (ARNO3, GRP1) 9265 399 Gateway... Gateway GEF Psd4 (EFA6B) 23550 1056 Mammalian (pEGFP-C1) GEF Fbxo8 (FBX8) 26269 319 Gateway Return to... -
Zhang Lab CRISPR Page
TypeCollection... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted... -
Tetracycline Inducible Expression
TypeCollection...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or...Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP...Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS Jason Sheltzer 11651 pLVUT-tTR-KRAB... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...TLCV2 Lentiviral vector for tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf... -
Chemogenetics AAV Preps
TypeCollection...IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4...119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson 119742... Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre...PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 121538 pAAV SYN1 HA-hM4D(Gi) hM4D(Gi) - Inhibition HA ...