We narrowed to 27 results for: EYFP
-
TypeGuide...Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1...
-
Brain Armamentarium
TypeCollection...-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) Expression of ChR2(H134R)-EYFP in striatal cholinergic... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... 21741 Clathrin-LCa-EYFP Clathrin-coated vesicles Clathrin, light polypeptide EYFP Xiaowei Zhuang 14437... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...fluorescent reporter gene with cap-dependent 3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...nm) Brightness pKa Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP ... -
Trimmer Lab NeuroMab Collection
TypeCollection...Llama 135219 HS22 pEYFPN1 anti-Homer1 nanobody HS22 Homer1 Mouse Llama 135220 HC20 pEYFPN1 anti-Homer1 nanobody...Llama 135221 HS38 pEYFPN1 anti-Homer1 nanobody HS38 Homer1 Mouse Llama 135223 HC87 pEYFPN1 anti-Homer1 nanobody... -
Neurodegeneration Plasmid Collection
TypeCollection...MBP-mmA1 HNRNPA1 MBP ALS Sean Ryder 61155 C1A-C1A-EYFP PRKCG YFP CMV Spinocerebellar ataxia 17 Tobias Meyer...pTO_CHMP2B_LAP CHMP2B LAP CMV ALS Daniel Gerlich 101874 pEYFP-N1-Pink1 PINK1 YFP CMV Parkinson's Richard Youle...