We narrowed to 43 results for: IRES

...pAAV-hSyn-dF-HA-KORD-IRES-mCitrine kappa-opioid receptor (KOR) - Inhibition IRES mCitrine Cre-dependent...pAAV-hSyn-DIO-HA-hM3D(Gq)-IRES-mCitrine hM3D(Gq) - Activation HA fusion and IRES mCitrine Cre-dependent ...pAAV-hSyn-DIO-HA-hM4D(Gi)-IRES-mCitrine hM4D(Gi) - Inhibition HA fusion and IRES mCitrine Cre-dependent ... 119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Scott Sternson...Sternson 119742 AAV SYN PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Scott Sternson 119744...119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Scott Sternson 121538 pAAV...pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine hM4D(Gi) - Inhibition HA fusion and IRES mCitrine none 2, 8 Bryan...

...Chang-Zheng Chen 52114 pMSCV-IRES-mCherry FP MSCV A bicistronic retroviral plasmid with IRES-mCherry. Dario Vignali...encoding NAT instead of PAC. James Iglehart 20672 MSCV-IRES-GFP MSCV For transgene expression with a GFP marker...marker. Tannishtha Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid) MSCV For cloning and gene expression...transgene fused to eGFP. Hans Clevers 18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression...

... the 3' UTR David Bartel 101139 pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF) ...Luciferase Type(s) Description PI 64784 pGL3-Basic-IRES Firefly Insertion of 5' promoter/enhancer regions...controlling transcription Debrya Groskreutz 18760 MSCV IRES Luciferase Firefly Retroviral expression of firefly...for insertion of your gene of interest upstream of IRES-firefly luciferase. Bryan Welm 87067 pcDNA3.1-ccdB-Nanoluc...lysate Marcel Bruchez 108542 pLenti-EF1a-Luciferase-IRES-Blast-WPRE Firefly EF1α Lentiviral expression of...

...74(5):858-73. Pubmed PMID 22681690.  8, Wickersham IR, Finke S, Conzelmann KK, Callaway EM. Retrograde ...

...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse...

...pAAV-Ef1a-mCherry-IRES-Cre None Yes 55637 pAAV-EF1a-Flpo None Yes 55634 pAAV-EF1a-mCherry-IRES-Flpo None Yes...double transgenic animal strategy (PV-2a-Cre; SOM-IRES-Flp). Image from Fenno et al., 2014. INTRSECT INTRSECT...55635 pAAV-EF1a-sCre None No 55633 pAAV-EF1a-mCherry-IRES-Dre None No 183535 pAAV-CaMKIIa-Flpo None Yes Single...

... 5, 8, 9 James M. Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not a fusion tag) 8, rg* Karl ... none rg* Ian Wickersham 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a mCherry (not a fusion tag) 1, rg* Karl...

...Prep Description PI 65417-AAV8 pAAV-hSyn-dF-HA-KORD-IRES-mCitrine AAV packaging vector for hSyn driven KOR...Hillel Adesnik 109048-AAV9 pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST Anion channelrhodopsin GtACR1 fused to...Viviana Gradinaru 119741-AAV5 AAV SYN flex PSAM4 GlyR IRES EGFP Chemogenetics Cre-dependent expression plasmid...Scott Sternson 119741-AAV9 AAV SYN flex PSAM4 GlyR IRES EGFP Chemogenetics Cre-dependent expression plasmid...plasmid Scott Sternson 119742-AAV5 AAV SYN PSAM4 GlyR IRES EGFP Chemogenetics expression plasmid Scott Sternson...Sternson 119744-AAV5 AAV CAMKII PSAM4 GlyR IRES EGFP Chemogenetics expression plasmid Scott Sternson 123308...

...cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes (...expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth (Addgene viral...

...to use, integrate into host genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene ...reporter gene with cap-dependent 3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation for mammalian...

...61727 mCherry-Parkin-IRES-zeo PRKN mCherry Parkinson's Stephen Tait 61728 YFP-Parkin-IRES-zeo PRKN YFP Parkinson's...107543 pAAV-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Helene Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV...pLV-EF1a-KIF5A-HA-IRES-Puro KIF5A HA eF1a ALS Rosalind Segal 166953 pLV-EF1a-KIF5AR280H-HA-IRES-Puro KIF5A HA... MSCV-Fbxo7-IRES-GFP FBXO7 GFP Parkinson's Heike Laman 171787 MSCV-Fbxo7(deltaF-box)-IRES-GFP FBXO7 GFP... pAAV-hSyn-GFP-IRES-mSNCA SNCA GFP hSyn Parkinson's Jun Ding 185715 pAAV-hSyn-GFP-IRES-hSNCA SNCA GFP ...pAAV-hSyn-GFP-IRES-mSNCA(1-95) SNCA GFP hSyn Parkinson's Jun Ding 185717 pAAV-hSyn-GFP-IRES-hSNCA (A11P/...pAAV-hSyn-GFP-IRES-hSNCA (S129A) SNCA GFP hSyn Parkinson's Jun Ding 185719 pAAV-hSyn-GFP-IRES-hSNCA (S129D...

...Recombinases Patrick Aebischer 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a Cre and physically-separate mCherry expression...Recombinases James M. Wilson 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a Flpo and physically-separate mCherry expression...Inhibitor DREADD Bryan Roth 65417 pAAV-hSyn-dF-HA-KORD-IRES-mCitrine Syn Inhibitor DREADD Bryan Roth 154867 ...

...destabilized EGFP. Neville Sanjana 164432 pHAGE-CMV-Luc2-IRES-ZsGreen-W Lentiviral dual reporter vector expressing...

...Rabies and Neuronal Tracing References Wickersham IR, Finke S, Conzelmann KK, Callaway EM. 2007a. Retrograde...Nat Methods. 4(1):47-9. PMID: 17179932 Wickersham IR, Lyon DC, Barnard RJ, Mori T, Finke S, Conzelmann...

...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors...

.../hum.2019.277 Lavin TK, Jin L, Lea NE, Wickersham IR (2020) Monosynaptic Tracing Success Depends Critically...

...removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from...

...while wavelengths over 700 nm make up the infrared (IR) spectrum. When photons are absorbed by matter, they...

... additional variants. David Root 85140 pLV-hTERT-IRES-hygro 3rd Lentiviral expression of hTERT, used to...

...Constitutive 1 Karl Deisseroth 105921 pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Marcella Patrick...