We narrowed to 10 results for: IRES

...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse...

...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV...

...bacteriophage; requires T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires Sp6 RNA ...eukaryotes. In bacteria, the core RNA polymerase requires an associated sigma factor for promoter recognition...Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often...

...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...improve HDR efficiency . Remember that HDR also requires donor DNA to serve as template for the repair....: Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional activators...

...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...

... strand. Mimicking the DNA replication process requires the four nucleotides (dNTPs), a DNA polymerase...synthesis after their incorporation. Sanger sequencing requires a lot of DNA because the ultimate goal is to have...

...as a promoter on the transfer plasmid, and this requires Tat for activation. Second-generation plasmids...vectors from your plasmids (Figure 5). This process requires a production cell line, typically human embryonic...

...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...

...highly-tunable GPCR-based biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning...

...central (CNS) nervous systems. Targeting the CNS requires crossing the blood-brain barrier (BBB), and a ...