We narrowed to 11 results for: IRES
-
TypeGuide...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...
-
Adenovirus Guide
TypeGuide...different purposes. The pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP ...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV... -
Chemogenetics Guide
TypeGuide...window) Guettier JM, Gautam D, Scarselli M, de Azua IR, Li JH, et al. (2009). A chemical-genetic approach... -
Promoters
TypeGuide...Constitutive but requires T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires Sp6 RNA...eukaryotes. In bacteria, the core RNA polymerase requires an associated sigma factor for promoter recognition... -
Plan Your Experiment
TypeGuide...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...improve HDR efficiency . Remember that HDR also requires donor DNA to serve as template for the repair....: Target the transcription start site. CRISPRa requires dCas9 to be fused to transcriptional activators... -
CRISPR Guide
TypeGuide...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites... -
Lentiviral Vector Guide
TypeGuide...as a promoter on the transfer plasmid, and this requires Tat for activation. Second-generation plasmids...vectors from your plasmids (Figure 5). This process requires a production cell line, typically human embryonic... -
Molecular Biology Reference
TypeGuide... regions of interest. In vitro DNA replication requires the 4 nucleotides, a DNA polymerase enzyme, the...tagged base is incorporated. Sanger sequencing requires a lot of DNA because the ultimate goal is to have... -
Antibody Guide
TypeGuide...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody... -
Modular Cloning Guide
TypeGuide...highly-tunable GPCR-based biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning... -
Adeno-associated virus (AAV) Guide
TypeGuide...central (CNS) nervous systems. Targeting the CNS requires crossing the blood-brain barrier (BBB), and a ...