Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 103 results for: Myc-tagged Cre

Showing: 21 - 40 of 103 results

  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson...pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5 WT Early endosomes RAB5A DsRed2...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization... NLS mKalama1 Robert Campbell 73205 pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3 Nucleus NLS (from Mak16p protein)...

  2. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ... cells. Flexible tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable...Key elements (promoter, tag, polyA site) are flanked by unique restriction sites so you can swap sequences...plasmid set, our bacterial plasmid set for expressing tagged proteins, and stay tuned for mammalian expression...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...streptavidin immunoprecipitation (IP), and tandem mass tag (TMT) mass spectrometry (MS) in HCT116 cells (colorectal... stable: A puromycin resistance gene makes stable cell line creation a breeze. Modular by design: Key ...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with...

  3. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...is to tag the protein of interest with a small biochemical “epitope tag” such that these tagged proteins... the tagging efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) ...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if...endogenous gene tagging in human cells Plasmids 101: Protein Tags Fluorescent tagging of endogenous genes...each with a different tagged protein of interest, and a universal all-purpose “tag antibody” can be used...projects that require epitope tagging of a large cohort of genes (e.g. tagging genes representing a protein...pipeline for epitope tagging. Using our 96-format pipeline, we can routinely achieve 5-30% tag knock-in efficiency...

  4. Luciferase Plasmid Collection

    Type
    Collection
    ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...protein tags due to their large size (61 kDa and 36 kDa, respectively). And they are not secreted, so cells...PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV-CRISPR knockout plasmid...Lentiviral expression of firefly luciferase with a V5 tag Kevin Janes 99283 pCW57.1-Luciferase Firefly TRE ...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. Koen... : Biosensor using Renilla luciferase and a Halo tag to assay mRNA turnover in real time. Nonsense-mediated...

  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...ataxia Ronald Kahn 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald Kahn 11487 pET32a-HD16Q...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...

  6. Zebrafish Plasmid Collection

    Type
    Collection
    ...Knock-in tagging - Michel Bagnat lab. Targeting cassettes encoding fluorescent proteins for tagging genes...bearing either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish...resistant cell types. CreLite - George Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that ...toolbox of genetic methods, such as Tol2 transposons, Cre-mediated site-specific recombination, morpholinos...fluorescent proteins, reporters, biosensors, and Cre expression plasmids. Large collections or kits are...that are amenable to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9...

  7. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...dedifferentiation stage involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that...More (due to additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming...transdifferentiated in vivo to pancreatic β-like-cells with the expression of pancreatic and duodenal homoeobox...lineage, without dedifferentiating into a pluripotent stage. Cellular reprogramming The reversal of a differentiated...reprogramming [1]. The process can be divided into two stages: Dedifferentiation - Conversion of adult somatic...differentiated somatic cell to revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate...reprogrammed to iPSCs successfully [10-12]. The next stage of reprogramming consists of redifferentiation of...

  8. Sequencing Primers

    Type
    Guide
    ...promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end...

  9. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular tag, the IT6...production of a new series of epitope tags, inntags (innocuous tags), that they believe will have fewer ...expressed either without a tag or as multiple fusions with different N- and C-terminal tags. Additionally, by ...Unfortunately, while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause ...expression of fusions between the POI and a TAP tag (a tag with two epitopes that can be used to sequentially...the POI-tag fusion from a plasmid or from a random genomic location than to express the tagged protein...two dimeric Broccoli tags (2xdBroccoli) to further enhance fluorescence of the tagged RNA. Bacterial and...

  10. Tetracycline Inducible Expression

    Type
    Collection
    ...Neo-TRE-CMV-Cre-rtTA Dox-inducible expression of Cre recombinase. Madeline Lancaster 198752 DiLiCre 2.0 Dox-inducible...85040 pK170.AAV-TRE-Cre-WPRE (Supernova) AAV vector for dox-inducible expression of Cre recombinase. Takuji...63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase. Floris...Repressible Promoters Mammalian shRNA Plasmids Collection Cre-lox Plasmids Collection Stem Cell Research Plasmids...expression gene of interest fused with 3xFLAG and 2xStrep-tag from TRE3G promoter for Tandem-Affinity Purification...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...

  11. Starter guide to induced pluripotent stem cells (iPSCs) part 1:  A renaissance in regenerative medicine

    Type
    Blog Post
    ...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...which combined the advantages of both while limiting disadvantages led to the creation of induced pluripotent...therapeutic purposes. Both types have their advantages and disadvantages. Here is a table listing some of them...cells found in the zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell ...research. With all these benefits, iPSCs have increasingly become the ideal experimental system for research... Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine. ...

  12. How to Write a Scientific Review Article

    Type
    Blog Post
    ...you can sound credible and cool when you casually mention “Haery et al., showed that MYC expression was...was increased…” when discussing the review topic with your peers. Start reading! I started by reading ...retreat to the woods for months at a time, so take advantage of whatever time you have. If you’re like me, ...will also paraphrase what I have heard many other creative people say about writing: you don’t know what ...

  13. Bacterial Expression Systems

    Type
    Collection
    ...used tags, cleavage sites, and signal peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA,...bacteria with different purification tag combinations, including PelB tags for localization to the periplasm...Protein Expression Protein Expression Epitope Tags Protein Tags Return to top Protein Visualization To determine...Fluorescence (mCherry) Mycobacterium sp. Ashwani Kumar 134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity..., proteins are often expressed alongside epitope tags, which can also later be used for protein detection...removed using protease cleavage sites. Other protein tags and signal peptides are used to enhance protein ...HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA Cleavage sites: TEV protease, factor Xa, enterokinase...

  14. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol Cell. 2016. ...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...efficiency of screening for protein–protein interactions. The Roux lab has deposited HA tagged BioID2 for...through a large-scale expression screen that can be used to generate His-tagged human kinase constructs that...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...

  15. Molecular Biology Reference

    Type
    Guide
    ... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...

  16. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...hours worth of hands-on time. Creating a modular, selection-based gene tagging approach Multiple features...as the repair template plasmid to create fluorescent and 3xFLAG-tag fusion proteins. The repair template...added flanking loxP sites and a heat-shock inducible Cre to generate a self-excising cassette (SEC). To make... between a fluorescent protein (FP) and a 3xFLAG tag (see construct schematic below.) After self-excision...intron, and only the fluorescent protein and 3xFLAG-tag sequences are inserted into the genome. Figure.... (2015) illustrating the steps to fluorescently tag a C. elegans protein. The his-72 locus is shown as...little hands-on labor and could facilitate the tagging of every protein in the C. elegans genome. Although...

  17. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...Epitope tag antibody collection grows By Ashley Waldron We are excited to highlight the Anti-V5 tag antibody... as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile option for tagging proteins...immunodeficiency virus p27 using tag-specific monoclonal antibody and tag-linked antigen. J Gen Virol., ...Figure 3: Expression of fluorophore-tagged GOLG-4 through eight stages of embryonic development. Representative...find in this post: Anti-V5 and other new epitope tag antibodies from IPI New tool for structural studies...studies of E3 ligase cereblon Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene...Innovation (IPI), part of a new collection of epitope tag antibodies available through Addgene. Anti-V5 [IPI-SV5...

  18. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...electron microscopy (EM) tag providing superior subcellular localization of tagged proteins compared to traditional...additionally incorporates SUMO tags in the FP sequence for separation from Cre-based Brainbow-expressing cells...contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep, CBP, Trx, GST, Halo, MBP, ...promoter, N-terminal tag, coding sequence of the gene of interest, C-terminal tag, plant terminator, and...of an isopeptide bond between 2 peptide tags, SpyTag and KTag. The group demonstrated the use of the SpyLigase... short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated recombination to turn on or off the expression...a dual-color RNAi “sensor” mouse strain in which Cre expression causes the induction of both DsRed fluorescence...

  19. Targeted Mutagenesis with EvolvR

    Type
    Blog Post
    ... a unique tag into a genomic site of choice via the mutational abilities of PolI3m. This tag would allow...modular nature, the Dueber Lab created a few versions of EvolvR. To increase the mutation rate of EvolvR,...with a targeted mutagenesis rate ~9-fold higher than the original nCas9, while increasing the standard mutation...mutations to PolI3M generated PolI5M which increased EvolvR’s mutagenesis rate to ~10-3 mutations per nucleotide...bacteriophage T7 DNA polymerase increased the processivity of PolI3M, and thereby increasing the editing window of...result in a spectinomycin resistant phenotype in bacteria. While there are many known spectinomycin resistance... for mutagenesis, a feature which they used to generate bacteria resistant to both spectinomycin and streptomycin...

  20. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...construct, the neomycin resistance gene is floxed so that it can be removed post-selection through Cre-mediated...want to create a conditional knockout. To make a conditional knockout, researchers often use the Cre/Lox ...researchers usually remove it after selection using the Cre/Lox recombination system. After “floxing” the resistance... you can remove the gene through the addition of Cre recombinase (Figure 2). Figure 2: A knockout...make it possible to insert, or knock-in, any gene, tag, or mutated exon into the genome. For this purpose...example, you can remove a floxed resistance gene using Cre recombinase. If GFP is under control of an endogenous...promoter responds. You can also use this method to tag an endogenous protein with GFP, as seen in blue flame...
Showing: 21 - 40 of 103 results