Skip to main content

We narrowed to 97 results for: Myc-tagged Cre

Showing: 21 - 40 of 97 results
  1. Hot Plasmids February 2024

    Type
    Blog Post
    ...anti-FLAG tag antibodies By Ashley Waldron Of all the epitope tags we know and love, the FLAG tag (amino ...Endothelial-specific AAV delivery Recombinant anti-FLAG tag antibodies Peptide-assisted genome editing for ...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B... purify or image a recombinant protein, the FLAG tag has proven itself a good option for essentially all...collection includes over 10,000 plasmids with a FLAG tag (!), but did you know that we distribute ready-to-use...  Neurogenetic alchemy: CAP-Mac unleashes the secrets of primate brains with brilliance By Hridaya Patel...authors used a multispecies approach to generate and screen a library of AAV9 variants (Chuapoco et al., 2023...
  2. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ... viral particles that express oncogenes, such as Myc. Viral vectors also have the largest genomic footprint...transgenes is a concern as well, and reactivation of Myc or other oncogenes after differentiation has been...formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some...considered safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same...standard lentiviral vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes...including reporters and RNAi) for:  NANOG  OCT4 SOX2 MYC KLF4 LIN28 Check out these plasmids if you’re interested...due to the risk of insertional mutagenesis. Random integration also creates heterogeneous iPSC cell lines...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...Patrick Aebischer 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald Kahn 11487 pET32a-HD16Q...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...
  4. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ... been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and... transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...light-dependent Gal4 transcriptional activation and Cre recombination. Find PhoCl plasmids at Addgene. Zhang... for easy removal of the resistance cassette via Cre recombination. Each knockout includes unique barcodes...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...
  5. Tetracycline Inducible Expression

    Type
    Collection
    ...Neo-TRE-CMV-Cre-rtTA Dox-inducible expression of Cre recombinase. Madeline Lancaster 198752 DiLiCre 2.0 Dox-inducible...85040 pK170.AAV-TRE-Cre-WPRE (Supernova) AAV vector for dox-inducible expression of Cre recombinase. Takuji...63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase. Floris...expression gene of interest fused with 3xFLAG and 2xStrep-tag from TRE3G promoter for Tandem-Affinity Purification...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...Dox-inducible expression of a light-activated Cre recombinase. Jacco van Rheenen 104102–104112 TetBow Series...
  6. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ... cells. Flexible tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable...Key elements (promoter, tag, polyA site) are flanked by unique restriction sites so you can swap sequences...plasmid set, our bacterial plasmid set for expressing tagged proteins, and stay tuned for mammalian expression...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...streptavidin immunoprecipitation (IP), and tandem mass tag (TMT) mass spectrometry (MS) in HCT116 cells (colorectal... stable: A puromycin resistance gene makes stable cell line creation a breeze. Modular by design: Key ...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with...
  7. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...is to tag the protein of interest with a small biochemical “epitope tag” such that these tagged proteins... the tagging efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) ...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if...endogenous gene tagging in human cells Plasmids 101: Protein Tags Fluorescent tagging of endogenous genes...each with a different tagged protein of interest, and a universal all-purpose “tag antibody” can be used...projects that require epitope tagging of a large cohort of genes (e.g. tagging genes representing a protein...pipeline for epitope tagging. Using our 96-format pipeline, we can routinely achieve 5-30% tag knock-in efficiency...
  8. Bacterial Expression Systems

    Type
    Collection
    ...used tags, cleavage sites, and signal peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA,...bacteria with different purification tag combinations, including PelB tags for localization to the periplasm...Protein Expression Protein Expression Epitope Tags Protein Tags Return to top Protein Visualization To determine...Fluorescence (mCherry) Mycobacterium sp. Ashwani Kumar 134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity..., proteins are often expressed alongside epitope tags, which can also later be used for protein detection...removed using protease cleavage sites. Other protein tags and signal peptides are used to enhance protein ...HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA Cleavage sites: TEV protease, factor Xa, enterokinase...
  9. Neurodegeneration Research Collection

    Type
    Collection
    ...DNMT1 with a Myc tag. (Li et al. J Biol Chem. 2006) Express human ATM with Flag and His tags. (Canman et.... Express EGFP-tagged wt and mt tau . (Hoover et al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein...myelination. (Lam et al. Nat Commun. 2022) Endogenously tag gene variants for Alzheimer's disease and related...subcellular localization studies with GFP, or IP with Flag tag. (Bennett et al. Heliyon. 2020) Use VAP expression...Chemogenetics Plasmids . Find plasmids for endogenous gene tagging in human cells from the Allen Institute for Cell...blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons function...sporadic, having no prior family history. A small percentage (5–10%) are familial ALS cases having at least...
  10. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pTag-RFP-C-h-Rab5a-c-Myc Endosomes (early) Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Endosomes (early...pTag-BFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Endosomes...Harrison 79806 pTag-RFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc...) Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Endosomes (recycling) Rab4a TagBFP James Johnson...Corvera 42635 TagRFP-T-EEA1 Endosomes (early) EEA1 TagRFP-T Silvia Corvera 38770 pEF.myc.ER-E2-Crimson Endoplasmic...early) Rab5 TagBFP Gia Voeltz 61802 GFP-Rab5B Endosomes (early) Rab5B AcGFP Gia Voeltz 79802 pTag-RFP-C-h-...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...
  11. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...dedifferentiation stage involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that...More (due to additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming...transdifferentiated in vivo to pancreatic β-like-cells with the expression of pancreatic and duodenal homoeobox...lineage, without dedifferentiating into a pluripotent stage. Cellular reprogramming The reversal of a differentiated...reprogramming [1]. The process can be divided into two stages: Dedifferentiation - Conversion of adult somatic...differentiated somatic cell to revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate...reprogrammed to iPSCs successfully [10-12]. The next stage of reprogramming consists of redifferentiation of...
  12. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular tag, the IT6...production of a new series of epitope tags, inntags (innocuous tags), that they believe will have fewer ...expressed either without a tag or as multiple fusions with different N- and C-terminal tags. Additionally, by ...Unfortunately, while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause ...expression of fusions between the POI and a TAP tag (a tag with two epitopes that can be used to sequentially...the POI-tag fusion from a plasmid or from a random genomic location than to express the tagged protein...two dimeric Broccoli tags (2xdBroccoli) to further enhance fluorescence of the tagged RNA. Bacterial and...
  13. Starter guide to induced pluripotent stem cells (iPSCs) part 1:  A renaissance in regenerative medicine

    Type
    Blog Post
    ...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...which combined the advantages of both while limiting disadvantages led to the creation of induced pluripotent...therapeutic purposes. Both types have their advantages and disadvantages. Here is a table listing some of them...cells found in the zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell ...research. With all these benefits, iPSCs have increasingly become the ideal experimental system for research... Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine. ...
  14. How to Write a Scientific Review Article

    Type
    Blog Post
    ...you can sound credible and cool when you casually mention “Haery et al., showed that MYC expression was...was increased…” when discussing the review topic with your peers. Start reading! I started by reading ...retreat to the woods for months at a time, so take advantage of whatever time you have. If you’re like me, ...will also paraphrase what I have heard many other creative people say about writing: you don’t know what ...
  15. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...
  16. Control AAV Preps

    Type
    Collection
    ...Activity Cre-dependent Flp-dependent Cre and Flp-dependent Cre, Flp, and VCre-dependent Constitutive (non-cre-dependent...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity...fluoresce) Cre dependent 1, 5 Loren Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9...and mTFP Cre dependent 9 Joshua Sanes 209658 pAAV.CAGFLEX.(cyto).cpSFGFP.HaloTag CAG None Cre dependent...(non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-...floxed-mCherry-WPRE-HGHpA EF1a mCherry Cre dependent 9 Karl Deisseroth 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2,...EF1a mScarlet Cre dependent 1, 5 Karl Deisseroth 50457 pAAV-hSyn-DIO-EGFP hSyn EGFP Cre dependent 1, 2...
  17. Retrovirus Plasmids

    Type
    Collection
    ...See plasmid 8452 for puromycin resistance. William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline...Tetracycline inducible expression of GFP T2A Cre fusion in mammalian cells. Floris Foijer 47916 pRXTN CMV/MSV A ...Conditional overexpression plasmid. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and...Alice Wong 83356 pMXs-3XHA-EGFP-OMP25 MoMSV For tagging mitochondria with HA epitopes in mammalian cells...Expression of hTERT for creation of immortalized cells. See plasmid 1771 for puromycin selection, and plasmid...cloning and gene expression. Select with puromycin or screen for GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE... genome into a host cell. Scientists can take advantage of this to stably integrate transgenes of interest...
  18. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol Cell. 2016. ...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...efficiency of screening for protein–protein interactions. The Roux lab has deposited HA tagged BioID2 for...through a large-scale expression screen that can be used to generate His-tagged human kinase constructs that...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...
  19. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...hours worth of hands-on time. Creating a modular, selection-based gene tagging approach Multiple features...as the repair template plasmid to create fluorescent and 3xFLAG-tag fusion proteins. The repair template...added flanking loxP sites and a heat-shock inducible Cre to generate a self-excising cassette (SEC). To make... between a fluorescent protein (FP) and a 3xFLAG tag (see construct schematic below.) After self-excision...intron, and only the fluorescent protein and 3xFLAG-tag sequences are inserted into the genome. Figure.... (2015) illustrating the steps to fluorescently tag a C. elegans protein. The his-72 locus is shown as...little hands-on labor and could facilitate the tagging of every protein in the C. elegans genome. Although...
  20. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...Epitope tag antibody collection grows By Ashley Waldron We are excited to highlight the Anti-V5 tag antibody... as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile option for tagging proteins...immunodeficiency virus p27 using tag-specific monoclonal antibody and tag-linked antigen. J Gen Virol., ...Figure 3: Expression of fluorophore-tagged GOLG-4 through eight stages of embryonic development. Representative...find in this post: Anti-V5 and other new epitope tag antibodies from IPI New tool for structural studies...studies of E3 ligase cereblon Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene...Innovation (IPI), part of a new collection of epitope tag antibodies available through Addgene. Anti-V5 [IPI-SV5...
Showing: 21 - 40 of 97 results