Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 110 results for: chm

Showing: 21 - 40 of 110 results

  1. New CRISPR Tools: Cas7-11 and PASTE

    Type
    Blog Post
    ... cells. Moreover, they optimized the specific attachment sites via sequence engineering, enabling even...Eleonora I. Ioannidi, Matthew T. N. Yarnall, Cian Schmitt-Ulms, Rohan N. Krajeski, Justin Lim, Lukas Villiger...

  2. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...called BLESS (direct in situ breaks labeling, enrichment on streptavidin and next-generation sequencing.../biot.201400046  Strecker J, Jones S, Koopal B, Schmid-Burgk J, Zetsche B, Gao L, Makarova KS, Koonin ...

  3. Hot Plasmids - November 2023

    Type
    Blog Post
    ...one enzyme’s substrate, then the other, a dual-enrichment and mass spectrometry workflow identifies proteins...and APEX2 at different cellular locations. C) Enrichment of dual-labeled proteins identifies proteins ...

  4. Plasmids 101: Codon usage bias

    Type
    Blog Post
    ...regions a chance to fold properly. For example Pechmann and Frydman found that tracts of non-optimal codons...20506237. PubMed Central PMCID: PMC2970903. 6. Pechmann, Sebastian, and Judith Frydman. "Evolutionary ...

  5. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...RK2 (IncP), RSF1010 (IncQ), and pSa (IncW)  (Schmidhauser et al. 1988; Lale et al 2011; Jain and Srivastava... 326–332. https://doi.org/10.1002/bit.22695  Schmidhauser, T. J., Ditta, G., & Helinski, D. R. (1988)....

  7. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...Plasmids 101: Aptamer Fluorophores describes the enrichment process used to evaluate oligonucleotides for...systematic evolution of ligands by exponential enrichment (SELEX). After 4-6 rounds of SELEX, the RNA pool...

  8. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...Plasmid #67178) for use in the system outlined in Schmid-Burgk, J.L., et al (2). In this post, I’ll cover... 22894855. PubMed Central PMCID: PMC3501149. 2. Schmid, J.L., et al. (2016) CRISPaint allows modular base-specific...

  9. CRISPR Guide

    Type
    Collection
    ...A., Waldhauer, M. C., Börner, K., Fakhiri, J., Schmelas, C., Dietz, L., Grimm, D., Correia, B. E., Eils...Simpson, D., Zhao, A., Li, H., Yan, W., Goudy, L., Schmidt, R., Solley, S. C., Gilbert, L. A., Chan, M. M.... 31189177 Strecker, J., Ladha, A., Gardner, Z., Schmid-Burgk, J. L., Makarova, K. S., Koonin, E. V., &...: 34478496 Yarnall, M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L...

  12. Immunology Research Plasmids and Resources

    Type
    Collection
    ...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LTB4R leukotriene B4 receptor BLT1, BLTR, CMKRL1...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LEFTY1 left-right determination factor 1 LEFTB...PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS,...

  13. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...CRISPR Knockout Library 104861 Knockout Mouse Teichmann N/A (retroviral) 5 90,230 RNA-Binding Protein ...Pooled Library (Brunello) 223064 Knockout Human Schmid-Burgk 3rd 4 76,441 No available items found to ...

  14. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ... or fluorescent molecules such as Fluoro-Gold (Schmued and Fallon, 1986) are used. To facilitate cellular...PMID: 22418061. PubMed Central PMCID: PMC3381869. Schmued L.C., and Fallon J.H. (1986). Fluoro-Gold: a new...

  15. Validated gRNA Sequences

    Type
    Collection
    ...25490046 Schmitt-Ulms Prnp M. musculus TTGGCCCCATCCACCGCCAT 61856 cut S. pyogenes 25490046 Schmitt-Ulms Pten...

  16. CRISPR Guide

    Type
    Guide
    ...A., Waldhauer, M. C., Börner, K., Fakhiri, J., Schmelas, C., Dietz, L., Grimm, D., Correia, B. E., Eils...Simpson, D., Zhao, A., Li, H., Yan, W., Goudy, L., Schmidt, R., Solley, S. C., Gilbert, L. A., Chan, M. M.... 31189177 Strecker, J., Ladha, A., Gardner, Z., Schmid-Burgk, J. L., Makarova, K. S., Koonin, E. V., &...: 34478496 Yarnall, M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L...
Showing: 21 - 40 of 110 results