We narrowed to 16 results for: chm
-
TypeCollection...pLNCX2-mEGFP-CHMP2B CHMP2B GFP CMV ALS Sanford Simon 115331 pLNCX2-mCherry-CHMP2B CHMP2B mCherry CMV ALS...Dementia Gerold Schmitt-Ulms 61857 MLM3636-Prnp-CDS-Pos PRNP hU6 Dementia Gerold Schmitt-Ulms 61946 4QQ6...LTR VWM disease Seiichi Oyadomari 101848 pTO_CHMP2B_LAP CHMP2B LAP CMV ALS Daniel Gerlich 101874 pEYFP-...ALS Sanford Simon 115333 pLNCX2-mCherry-CHMP2B-siRNAres CHMP2B mCherry CMV ALS Sanford Simon 115523 MSCV-human...Spinocerebellar ataxia 6 Michael Ward 178153 CHMP2B_Halo_C_allele CHMP2B Halo ALS Michael Ward 178154 COQ2_Halo_N_allele...2N4R-EGFP MAPT GFP TREtight Parkinson's, FTD Gerold Schmitt-Ulms 132393 AAVS1 CAG rtTA3 TauP301L 2N4R-EGFP ...2N4R-EGFP MAPT GFP TREtight Parkinson's, FTD Gerold Schmitt-Ulms 133320 pHBS834 H14-SUMO-TDP43 WT-TEV-mCherry ...
-
Bikard Lab - CRISPR Repression Collection
TypeCollection...integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed information about...promoter integrated in the chromosome at phage attachment sites. The levels of the two reporters, mCherry... -
CRISPR Guide
TypeCollection...A., Waldhauer, M. C., Börner, K., Fakhiri, J., Schmelas, C., Dietz, L., Grimm, D., Correia, B. E., Eils...Simpson, D., Zhao, A., Li, H., Yan, W., Goudy, L., Schmidt, R., Solley, S. C., Gilbert, L. A., Chan, M. M.... 31189177 Strecker, J., Ladha, A., Gardner, Z., Schmid-Burgk, J. L., Makarova, K. S., Koonin, E. V., &...: 34478496 Yarnall, M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L... -
Immunology Research Plasmids and Resources
TypeCollection...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LTB4R leukotriene B4 receptor BLT1, BLTR, CMKRL1...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LEFTY1 left-right determination factor 1 LEFTB...PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS,... -
CRISPR Pooled gRNA Libraries
TypeCollection...CRISPR Knockout Library 104861 Knockout Mouse Teichmann N/A (retroviral) 5 90,230 RNA-Binding Protein ...Pooled Library (Brunello) 223064 Knockout Human Schmid-Burgk 3rd 4 76,441 No available items found to ... -
Validated gRNA Sequences
TypeCollection...25490046 Schmitt-Ulms Prnp M. musculus TTGGCCCCATCCACCGCCAT 61856 cut S. pyogenes 25490046 Schmitt-Ulms Pten... -
Botman-Teusink Yeast FP Collection
TypeCollection... new window) References Botman D, de Groot DH, Schmidt P, Goedhart J, Teusink B. In vivo characterisation... -
AAV Molecular Tools
TypeCollection...EGFP-tagged ribosomal L10a 5, rg* Heintz , Nectow , Schmidt Neurophysiology Tools These AAV encode tools that... -
Synthetic Biology - Overview
TypeCollection...Parniske Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela Silver Lei Stanley Qi Jeff Tabor... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc Swachmann-Bodian-Diamond Syndrome Gene (sbds) OZ545 and ... -
TALEN Guide
TypeCollection...Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF... -
TALEN Plasmids and Kits
TypeCollection... selection cassettes on pTAL7a and pTAL7b for enrichment of double-transfected mammalian cells. In addition... -
Retrograde AAV viral preps
TypeCollection...Cre-dependent Molecular Tool Heintz , Nectow , Schmidt No available items found to match all requested... -
The Pleiades Promoter Project
TypeCollection...Milisavljevic M, Mis J, O'Connor K, Palma B, Palmquist DL, Schmouth JF, Swanson MI, Tam B, Ticoll A, Turner JL, Varhol... -
Antibody Guide
TypeCollection...recognize the protein in its native conformation. Attachment of the antibody to the beads is typically done... -
Cre-lox system
TypeCollection...; arabinose inducible. PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting...