We narrowed to 73 results for: gag pol
-
TypeCollection...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGACTCCGTCccgtcgtGCTGAGGGCc hnf1a OZ521 and OZ522 OPEN OPEN aACCTTCCCCagagaGAGGTAGTGg VDAC2 OZ523...cACCCTCCTCgtggtGCTGGTGGCc apoeb (apolipoprotein Eb) OZ529 and OZ530 OPEN OPEN gCCCCTCAGCccagatgGGAGGAGATg dpf2 OZ531 and...OPEN OPEN tGTCTCCGGCagaggGAGGAGGAGa esrrga OZ563 and OZ564 CODA CODA tAGCTACCGCTGGCGTCTGAGGAGc HACE1 OZ565...CODA CODA gCTCATCTCCACCGAGCTGGAGAAg atp2c1 OZ567 and OZ568 CODA CODA tTACCTCCACGATCTTGCTGATGGAg dio2 OZ569...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...OPEN OPEN cAGCACCAGCCAGCCCAGAGTTGGGGt yap1 OZ589 and OZ590 CODA OPEN gCCCAGCTGCAGGGAGGCAGGTGAGg pdeb3 OZ591...
-
Immunology Research Plasmids and Resources
TypeCollection...receptor (TCR) engages with antigen presenting cells of the innate immune system. Engagement of the TCR by...class I polypeptide-related sequence A FLJ60820, MGC111087, PERB11.1 MICB MHC class I polypeptide-related...catalytic, delta polypeptide p110D PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide PI3CG, PI3K...gonadotropin, beta polypeptide CGB3, hCGB CGB1 chorionic gonadotropin, beta polypeptide 1 - CGB2 chorionic... gonadotropin, beta polypeptide 2 - CGB5 chorionic gonadotropin, beta polypeptide 5 HCG, MGC119822 CGB7... beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta polypeptide 8 - CHGA... - GIP gastric inhibitory polypeptide - GIPR gastric inhibitory polypeptide receptor MGC126722 GKN1 gastrokine... -
Plasmids for Stem Cell Research
TypeCollection...Single polycistronic lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral...27(5):1042-9. Townes Lentivirus Human Single polycistronic lentiviral vector for the expression of human...(8):1221-9. Cibelli Lentivirus Human Single polycistronic, doxycycline-inducible lentiviral vector for...Non-integrating mini-intronic plasmid (MIP) polycistronic expression of human Oct4, Klf4, Sox2, c-Myc ...episome Human Non-integrating EBNA1-mediated polycistronic expression of human Sox2, KLF4, L-Myc, Lin28...Replicating EBNA1 episome Human Non-integrating polycistronic expression of human Oct4, Klf4, Sox2, c-Myc,...episome Human Non-integrating EBNA1-mediated polycistronic expression of human Oct4, Sox2, Myc, Klf4, BCL2L1... -
With an Eye Towards the Future, We Look Back at the March for Science
TypeBlog Post...interested in global health policy. He is also chair of the postdoctoral engagement committee and active member... scientists must rise up and become more politically engaged. I was proud to be a part of a community ...approach policy makers take in abusing climate science skepticism to promote harmful policies that benefit...move slowly, news about possible broad changes to policies seems to break everyday. Many researchers and ...participation in government, evidence to inform policies, a protected place to work, funding for science...medicines, technologies, defense, and governing policies are developed primarily by wishful thinking. The...rains, it was weather befitting of the ominous political climate in which American scientists find themselves... -
10 Steps to a Perfect Science Talk
TypeBlog Post...experiment with other ways to engage the audience. Take an informal poll by asking for a show of hands...of useful, entertaining science lab, career, and policy content. Watch Joanne give her "Not" Networking...the best ways to make you and your presentations engaging and memorable. If you read my story above about... results, striking images, creative ideas, and engaging stories as you encounter or experience them. Drop...almost anyone with enough practice. I always take a poll of scientists in training to see how many in my ...to be conversational - the audience should feel engaged and not like they’re sitting through a pre-recorded...from the speaker, but actually makes for a more engaging session. The best speakers use no notes and can... -
Molecular Biology Reference
TypeGuide...Glutamine Gln Q CAA, CAG Glutamic Acid Glu E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H ...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one... -
Plasmid Cloning by PCR
TypeBlog Post...use a high fidelity polymerase to minimize mutations. The fidelity of the polymerase becomes more important... million bp depending on the polymerase used. No matter which polymerase you use, it is important that.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Preparing the PCR product for... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...μg/mL polybrene. TIP: Polybrene increases the efficiency of viral infection. However, polybrene is toxic...drives RNA Polymerase III transcription for generation of shRNA transcripts. cPPT Central polypurine tract,...especially repeated Ts because polyT is a termination signal for RNA polymerase III. Note that these were ... sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense... for 12-15 hours. c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail .... Hexadimethrine Bromide (Polybrene) Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268...Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: ... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post... and surveyor. Q15: I used DNA polymerase Takara Ex Taq™ DNA Polymerase for my genomic PCR, but couldn't...In our hands, Herculase II Fusion polymerase or Kapa Hifi Polymerase work very well. Some groups have ...your HR by doing Restriction Fragment Length Polymorphism (RFLP) (see Figure 4 of the Cong et. al (2013...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post... directly engages the ribosome for translational complex assembly. PhD student Dejan Gagoski then used... a duplicated SV40 polyadenylation region instead of the synthetic polyadenylation signal present in pGL3...system for light-activated CRISPR-Cas9 effector, Polstein and Gersbach fused the light-inducible protein... accessible for many potential applications. Polstein LR & Gersbach CA, Nat Chem Biol 2015 Mar;11(3)...recruits up to 24 copies of a protein to a target polypeptide. Multimerization in the SunTag system occurs ... simplifies the process of creating complex polycistronic lentiviruses. The MuLE toolbox contains a series...constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces for inducible expression... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol... high fidelity taq polymerase to minimize mutations. The fidelity of the polymerase becomes more important...bp depending on the polymerase used. Because of this, no matter which taq polymerase you use, it is important.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR... -
Savvy Advocates Needed to Navigate a Scientific Enterprise in Flux
TypeBlog Post...revealed that young scientists are aware of, and are engaged in, these issues which will continue to shape the.... The topic of unionization continues to be a polarizing one. High-profile universities remain outspoken...science funding and funding mechanisms require an engaged sector with effective advocacy skills. Advocating... panelists including: Kate Stoll, PhD - Senior Policy Advisor MIT Washington Office Ben Corb - Director... in the intersection between science and public policy. Follow David on Twitter @driglar. References... -
How-to: 5 Steps to a Great Panel Discussion
TypeBlog Post...discussions with both panelists and audience fully engaged. They can also be dull and painful to sit through...well-planned approach to making the event interesting and engaging. Long before the event... Choose a moderator ...advantage of the program. Start the program by polling the audience with a few questions. Who is out there...in response. I am always ready with some written poll questions to get things started. Give a couple of...want to take over? It is the moderator's job to politely but firmly get them to stop talking and redirect... -
Multiple Plasmids at a Low Price: Kits from Addgene
TypeBlog Post...directly engages the ribosome for translational complex assembly. PhD student Dejan Gagoski used SITS...terminators can be used to precisely tune your polycistronic E. coli expression constructs. Some applications...both prokaryotic and eukaryotic cell extracts (Gagoski et al 2015). He has also constructed a library ...systems: E. coli, wheat germ, HeLa, and Leishmania (Gagoski, et al 2015[2]). The proteins encoded in this set... -
The Strength of Story Telling
TypeBlog Post...meetings. When scientists tell good stories, they engage their readers or listeners thus expanding the impact...it for a while and he eventually calmed down, apologised and admitted he’d been under a lot of pressure...invite people to ask questions, be approachable. Engage with your audience and try to learn from them. ... again until you work out what people enjoy and engage with and what parts you can leave out. Start viewing... -
Virtual Science Conference Coming Up? Three Addgenies Share Their Experience
TypeBlog Post...presenter, it can be difficult to keep the audience engaged through a computer screen. For the Reproducibility...organizers found several avenues to keep the audience engaged. They first sent a pre-workshop questionnaire to...are still other ways to make your session more engaging, for example, by using short animations and visuals...visuals, or asking questions using the polling feature or the chat box. One key thing to remember regardless... -
A Deep Dive into BioBuilder
TypeBlog Post...are asking. Teachers are also asking, “How do I engage my students in real-world lab activities? I’m trying...classroom are characterized by intense student engagement and joy, rather than a perfect lesson plan or... this fall: The BioBuilderClub BioBuilderClub engages high school teams around the world who combine ...whose work is focused on education and education policy. Additional Resources on the Addgene Blog Synthetic... -
CRISPR 101: Cas9 vs. The Other Cas(s)
TypeBlog Post...curious feature of this Cas is that once it is engaged by its target, it will non-specifically cut ssDNA...indiscriminately cleaves non-complementary ssDNA when engaged by its target sequence. Why would you want to give...to detect variants such as single nucleotide polymorphisms. Fast facts – PAM requirement: none. Best ...Cas14, also indiscriminately cleaves ssRNA when engaged at its RNA target sequence. The RNA-targeting ability... -
AAV ddPCR Titration
TypeProtocol... Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT ITR Probe: -FAM-CACTCCCTCTCTGCGCGCTCG-BBQ...1814040 Microseal adhesive seal, Bio-Rad, MSB1001 Polystyrene Reservoirs, VWR, 89094-662 Microcentrifuge tubes... the NTC. Pour the 1X dilution buffer into a polystyrene reagent reservoir. Using a 20–200 µL multichannel...cartridge. Add 800 µL of droplet generation oil to a polystyrene reagent reservoir. Using the 20–200 µL multichannel... -
Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs
TypeBlog Post... development, business development, consulting, policy, big data and the list goes on and on. As you think...Hire American" Executive Order which sets broad policy intentions directing federal agencies to propose...your company employs at least 3 full-time people engaged in researcher activities. The EB-1B requires that...meets the requirements set forth by USCIS before engaging with clients. To learn more, visit www.casseuslaw.com...