We narrowed to 45 results for: ires-mcherry

...the absence of Cre. mCherry expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from ... cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes...

...Constitutive 5 Hongkui Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Edward Boyden 59462 pAAV-CAG-tdTomato...pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Marcella Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa...CaMKIIa mCherry Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Karl Deisseroth 114470 pAAV-Ef1a-mCherry EF1a mCherry... PHP.eB Karl Deisseroth 114472 pAAV-hSyn-mCherry hSyn mCherry Constitutive 1, 2, 5, 8, 9, rg* Karl Deisseroth...Zhang 20299 pAAV-EF1a-double floxed-mCherry-WPRE-HGHpA EF1a mCherry Cre dependent 9 Karl Deisseroth 27056...112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent 1, 2, 5, ...8, 9, rg* Bryan Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1, 2, 5, 8, 9, rg* Bryan Roth...

... PI 44965 NL4-3 mCherry Luciferase Lentiviral dual reporter vector expressing mCherry and firefly luciferase...destabilized EGFP. Neville Sanjana 164432 pHAGE-CMV-Luc2-IRES-ZsGreen-W Lentiviral dual reporter vector expressing... a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the live...

... 3’ UTR of the reporter mRNA is labeled by PCP-mCherry (Figure 2). The 3’ UTR also contains a CAAX sequence...membrane; this sequence prevents diffusion of the mCherry labeled mRNA and keeps it in a single field of ...frequency. Although highly useful, this technique requires extensive sample processing to avoid disrupting...appear red. To enable this color switching, TRICK requires the following components: a GFP protein that ...caveats. In both cases, creating a reporter mRNA requires inserting multiple hairpin sequences into the ...

...ChR2-mCherry nEF ChR2 mCherry Cre dependent 8 Karl Deisseroth 137144 pAAV-nEF-Coff/Fon-ChR2-mCherry nEF...)-TS-mCherry EF1a C1V1 (t/t) mCherry Cre dependent 9 Karl Deisseroth 92207 TRE-ChrimsonR-mCherry TRE ChrimsonR...Karel Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Gordon Fishell...Fishell 135634 pAAV-S5E2-ChR2-mCherry nEF ChR2 mCherry Constitutive 1, 9, PHPeB Jordane Dimidschstein 137142... 137142 pAAV-nEF-Con/Fon-ChR2-mCherry nEF ChR2 mCherry Cre and Flp dependent 8 Karl Deisseroth 137143 ...pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA EF1a ChR2/H134R mCherry Cre dependent 1, 5, 8, 9, rg*...Deisseroth 26975 pAAV-CaMKIIa-hChR2(H134R)-mCherry CaMKII ChR2/H134R mCherry Constitutive 1, 5, 9, rg* Karl Deisseroth...

...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse...binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry Forward mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward...

... from the EF1 promoter pCDH-CMV-mCherry-T2A-Puro 72264 Express mCherry and puromycin resistance gene from...removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from...

... as the first letter in the protein name, e.g. mCherry). Oxygen: The maturation of the chromophore on ...sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours...many FPs (particularly those derived from GFP) requires oxygen. Therefore, these FPs cannot be used in...

...mutagenesis screening for enhanced RFP variants. PA-mCherry (E26V / A58T / K69N / L84F / N99K / S148L / I165V...UV-Violet or blue Green/ Red 4,500 High 553/ 573 PA-mCherries Monomer UV-Violet Dark/ Red >3,000 Medium 570/.... 2.Subach, Fedor V., et al. "Photoactivatable mCherry for high-resolution two-color fluorescence microscopy...one since the formation of mEosFP’s chromophore requires a temperature below 30°C and this is not ideal...fluorescence localization data. However, this technique requires harsh fixation conditions to preserve cellular...

...), tagRFP (pKa = 3.1) and mCherry (pKa = 3.8). We have observed that mCherry (and mTurquoise2, not shown...myristoylation requires an N-terminal consensus sequence (MG-) and prenylation requires a C-terminal consensus... 2002). GFP needs oxygen Chromophore formation requires a fully folded beta-barrel structure, followed...chromophore (Tsien, 1998). Importantly, this reaction requires molecular oxygen and as a consequence GFP remains...

... ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin...mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or...one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize simultaneously...mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment...for a protein of interest (POI). This technique requires the production and expression of fusions between...

...Dmitri Wiederschain 36084 pLV-mCherry 3rd CMV driven expression of mCherry fusion. See 36083 and 36086 ... additional variants. David Root 85140 pLV-hTERT-IRES-hygro 3rd Lentiviral expression of hTERT, used to...

... Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used for...must be performed after primary purification and requires a second clean up step to remove the cleaved tag...Also, purifying GST by affinity chromatography requires proper folding of the tag, which prevents insoluble.... Mammalian purification is still possible but requires optimization and often more stringent washing....

...p2A-ferritin-p2A-mCherry Mammalian Expression 74308 pcDNA3.0-Magneto2.0-p2A-mCherry Mammalian Expression...and named it Magneto 2.0. Using Magneto2.0-p2A-mCherry constructs, the lab verified that Magneto2.0 was...Expression 74334 pCR8-Magneto2.0-p2A-mCherry Gateway 74333 pCR8-Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0...AAV 74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain...for more selective targeting of fusion proteins, requires less biotin, and shows enhanced labeling of proximate...addition, some versions of the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to...

...21217 PGK-H2BmCherry Chromatin H2B mCherry Mark Mercola 20972 H2B-mCherry Chromatin H2B mCherry Robert Benezra... sequence (COX4) mCherry Maria Harrison 37354 pQC NLS mCherry IX Nucleus NLS mCherry Connie Cepko 14893...SKL) mCherry Maria Harrison 55146 mCherry-TOMM20-N-10 Mitochondria outer membrane TOMM20 mCherry* Michael...Murine E-cadherin mCherry Adherens junctions E-cadherin mCherry Alpha Yap 55114 mCherry-Paxillin-22 Focal...55165 mCherry-ZO1-C-14 Tight junctions Zonula Occludens-1 mCherry* Michael Davidson 55001 mCherry-Beta-... 55148 mCherry-Tubulin-C-18 Microtubules alpha-Tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha...ABCb10 EGFP Orian Shirihai 27705 CAV1-mCherry Caveolae Cav1 mCherry Ari Helenius 44385 pLV-mitoGFP Mitochondria...

...them with a fluorescent reporter, such as GFP or mCherry, through genetic modification. As your protein ...while wavelengths over 700 nm make up the infrared (IR) spectrum. When photons are absorbed by matter, they...

...(E123A)-mCherry Karl Deisseroth AV-1-35512 35512-AAV1 pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry Karl Deisseroth...20297-AAV1 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl Deisseroth AV-1-20298P...AV-1-26975 26975-AAV1 pAAV-CaMKIIa-hChR2(H134R)-mCherry Optogenetics Karl Deisseroth AV-1-35503 35503-AAV1...20297-AAV5 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl Deisseroth AV-5-20298P...AV-5-26975 26975-AAV5 pAAV-CaMKIIa-hChR2(H134R)-mCherry Optogenetics Karl Deisseroth AV-5-35509 35509-AAV5...20297-AAV9 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl Deisseroth AV-9-20298P...AV-9-26975 26975-AAV9 pAAV-CaMKIIa-hChR2(H134R)-mCherry Optogenetics Karl Deisseroth AV-9-35497 35497-AAV9...

...system pairs ubiquitous expression of sgRNA(s) and mCherry (vector 1) with neuron-specific expression of dCas9...., 2018). The pooled nature of this experiment requires fluorescence activated cell sorting (FACS) to ...

...Voigt 65008 pCRISPReporter-mCherry Promoter activity Fluorescence (mCherry) Escherichia coli Mattheos ...Tolker-Nielsen 90217 pMV762-Peredox-mCherry NADH:NAD+ ratio Fluorescence (mCherry) Mycobacterium sp. Ashwani Kumar...Fluorescence (mCherry) Escherichia coli David Summers 24659 pCHERRY3 Promoter activity Fluorescence (mCherry) Mycobacterium...187836 pVoPo-01 Promoter activity Fluorescence (mCherry) Fusobacterium nucleatum Jörg Vogel 46002 pGR Terminator...expression from that element. When this activation requires a transcription factor to bind to a small molecule...

... are named for soup ingredients! From pSOUP to mCherry, satisfying ingredients reagents permeate the molecular...instability at 37°C (Ouellet et al., 2016) and requires a tRNA scaffold to improve its stability in vivo...