...4x-FLAG-mCherry-H2B), cytoskeletal (middle, 4xFLAG-mCherry-β-actin), and mitochondrial (mito-mCherry-1xFLAG...while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG frankenbody...label your favorite protein! While the target only requires a small epitope tag (FLAG is eight amino acids...

...the absence of Cre. mCherry expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from ... cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral genomes...

...pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive...AAV-EF1a-BbChT EF1a mCherry and mTFP Cre dependent 9 Sanes 114471 pAAV-Ef1a-fDIO mCherry EF1a mCherry Flp dependent...Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato... rg*, PHP.eB Deisseroth 114470 pAAV-Ef1a-mCherry EF1a mCherry Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...PHP.eB Deisseroth 114472 pAAV-hSyn-mCherry hSyn mCherry Constitutive 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1...112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent 1, 2, 5, ...1, 2, 5, 8, rg* Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1, 2, 5, 8, 9, rg* Roth 51502...

...ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter vector expressing mCherry and firefly luciferase...vector expressing firefly luciferase. pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing... a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the live...

...-ChR2-mCherry nEF ChR2 mCherry Cre dependent 8 Deisseroth 137144 pAAV-nEF-Coff/Fon-ChR2-mCherry nEF ChR2...1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell 135634...135634 pAAV-S5E2-ChR2-mCherry nEF ChR2 mCherry Constitutive 1, 9, PHPeB Dimidschstein 137142 pAAV-nEF-...pAAV-nEF-Con/Fon-ChR2-mCherry nEF ChR2 mCherry Cre and Flp dependent 8 Deisseroth 137143 pAAV-nEF-Con/Foff 2.0...pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA EF1a ChR2/H134R mCherry Cre dependent 1, 5, 8, 9, rg*...Deisseroth 26975 pAAV-CaMKIIa-hChR2(H134R)-mCherry CaMKII ChR2/H134R mCherry Constitutive 1, 5, 9, rg* Deisseroth...Deisseroth 26976 pAAV-hSyn-hChR2(H134R)-mCherry Syn ChR2/H134R mCherry Constitutive 5, 8, 9 Deisseroth 28017...

... 3’ UTR of the reporter mRNA is labeled by PCP-mCherry (Figure 2). The 3’ UTR also contains a CAAX sequence...membrane; this sequence prevents diffusion of the mCherry labeled mRNA and keeps it in a single field of ...frequency. Although highly useful, this technique requires extensive sample processing to avoid disrupting...appear red. To enable this color switching, TRICK requires the following components: a GFP protein that ...caveats. In both cases, creating a reporter mRNA requires inserting multiple hairpin sequences into the ...

... from the EF1 promoter pCDH-CMV-mCherry-T2A-Puro 72264 Express mCherry and puromycin resistance gene from...removed to increase the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from...

...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry, forward primer mCherry-R TTGGTCACCTTCAGCTTGG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...TTGGTCACCTTCAGCTTGG 5' end of mCherry, reverse primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein...

... as the first letter in the protein name, e.g. mCherry). Oxygen: The maturation of the chromophore on ...sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours...many FPs (particularly those derived from GFP) requires oxygen. Therefore, these FPs cannot be used in...

...mutagenesis screening for enhanced RFP variants. PA-mCherry (E26V / A58T / K69N / L84F / N99K / S148L / I165V...UV-Violet or blue Green/ Red 4,500 High 553/ 573 PA-mCherries Monomer UV-Violet Dark/ Red >3,000 Medium 570/.... 2.Subach, Fedor V., et al. "Photoactivatable mCherry for high-resolution two-color fluorescence microscopy...one since the formation of mEosFP’s chromophore requires a temperature below 30°C and this is not ideal...fluorescence localization data. However, this technique requires harsh fixation conditions to preserve cellular...

... pyogenes mCherry Luikart pDECKO_mCherry 78534 Mammalian hU6 none S. pyogenes Puro, mCherry Guigo BPK3079...BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI) 64217 Mammalian BbsI yes, cut S. pyogenes mCherry Kuhn pU6-(BbsI)_...CBh-Cas9-T2A-mcherry-P2A-Ad4E1B 64221 Mammalian see plasmid page yes, cut S. pyogenes mCherry Kuhn pU6-(...pU6-(BbsI)_CBh-Cas9-T2A-mCherry 64324 Mammalian BbsI yes, cut S. pyogenes mCherry Kuhn pEX-A-U6-gRNA 65626...CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6 64222 Mammalian see plasmid page yes, cut S. pyogenes mCherry Kuhn AAV:...pyogenes EGFP Jackson AIO-mCherry 74120 Mammalian U6x2 yes, nick S. pyogenes mCherry Jackson pMZ376 74213 ...pyogenes mCherry Savage pBLO1808_arC9_2xNLS_human 74491 Mammalian U6 yes, cut S. pyogenes mCherry Savage...

...), tagRFP (pKa = 3.1) and mCherry (pKa = 3.8). We have observed that mCherry (and mTurquoise2, not shown...myristoylation requires an N-terminal consensus sequence (MG-) and prenylation requires a C-terminal consensus... 2002). GFP needs oxygen Chromophore formation requires a fully folded beta-barrel structure, followed...chromophore (Tsien, 1998). Importantly, this reaction requires molecular oxygen and as a consequence GFP remains...

... ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin...mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or...one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize simultaneously...mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment...for a protein of interest (POI). This technique requires the production and expression of fusions between...

... Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used for...must be performed after primary purification and requires a second clean up step to remove the cleaved tag...Also, purifying GST by affinity chromatography requires proper folding of the tag, which prevents insoluble.... Mammalian purification is still possible but requires optimization and often more stringent washing....

...21217 PGK-H2BmCherry Chromatin H2B mCherry Mark Mercola 20972 H2B-mCherry Chromatin H2B mCherry Robert Benezra...55165 mCherry-ZO1-C-14 Tight Junctions Zonula Occludens-1 mCherry Michael Davidson 55001 mCherry-Beta-... PI 110060 FUW mCherry-GFP-LC3 Autophagosome LC3 mCherry, GFP Anne Brunet 40827 mCherry-hLC3B-pcDNA3.1... 55148 mCherry-Tubulin-C-18 Microtubules alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha...mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae Cav1 mCherry Ari Helenius 37533 cfSGFP2-N Extracellular...gamma GFP Tom Misteli 55068 mCherry-LaminA-C-18 Nuclear Envelope LaminA1 mCherry* Michael Davidson 98831 ...mTurquoise2 Dorus Gadella 55069 mCherry-LaminB1-10 Nuclear Envelope LaminB1 mCherry* Michael Davidson 98822 Lck-mTurquoise2...

...p2A-ferritin-p2A-mCherry Mammalian Expression 74308 pcDNA3.0-Magneto2.0-p2A-mCherry Mammalian Expression...and named it Magneto 2.0. Using Magneto2.0-p2A-mCherry constructs, the lab verified that Magneto2.0 was...Expression 74334 pCR8-Magneto2.0-p2A-mCherry Gateway 74333 pCR8-Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0...AAV 74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain...for more selective targeting of fusion proteins, requires less biotin, and shows enhanced labeling of proximate...addition, some versions of the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to...

...them with a fluorescent reporter, such as GFP or mCherry, through genetic modification. As your protein ...while wavelengths over 700 nm make up the infrared (IR) spectrum. When photons are absorbed by matter, they...

...(E123A)-mCherry Karl Deisseroth AV-1-35512 35512-AAV1 pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry Karl Deisseroth...20297-AAV1 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl Deisseroth AV-1-20298P...AV-1-26975 26975-AAV1 pAAV-CaMKIIa-hChR2(H134R)-mCherry Optogenetics Karl Deisseroth AV-1-35503 35503-AAV1...20297-AAV5 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl Deisseroth AV-5-20298P...AV-5-26975 26975-AAV5 pAAV-CaMKIIa-hChR2(H134R)-mCherry Optogenetics Karl Deisseroth AV-5-35509 35509-AAV5...20297-AAV9 pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA Optogenetics Karl Deisseroth AV-9-20298P...AV-9-26975 26975-AAV9 pAAV-CaMKIIa-hChR2(H134R)-mCherry Optogenetics Karl Deisseroth AV-9-35497 35497-AAV9...

...system pairs ubiquitous expression of sgRNA(s) and mCherry (vector 1) with neuron-specific expression of dCas9...., 2018). The pooled nature of this experiment requires fluorescence activated cell sorting (FACS) to ...

... are named for soup ingredients! From pSOUP to mCherry, satisfying ingredients reagents permeate the molecular...instability at 37°C (Ouellet et al., 2016) and requires a tRNA scaffold to improve its stability in vivo...