We narrowed to 33 results for: tdTomato
-
TypeCollection... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP...
-
Bacterial Expression Systems
TypeCollection...18084 54856 pBad-mAmetrine1.1 tdTomato-pBAD mAmetrine1.1 (donor) tdTomato (acceptor) FRET/Dual FRET Robert... 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-Sapphire (donor) tdTomato (acceptor) FRET Robert Campbell...Parish 24657 pASTA3 Promoter activity Fluorescence (tdTomato) Mycobacterium sp. Tanya Parish 24658 pCHARGE3... -
Hot Biosensors 2022: Year-End Roundup
TypeBlog Post...different thermal quenching rates (mNeonGreen and tdTomato), they produce a temperature sensor that significantly... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...Yellow-orange fluorescent proteins like TagRFP, tdTomato, DsRed, the mKate series, or tdKatushka2 (Drobizhev... -
Rett Syndrome
TypeCollection...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell... -
Recombinases AAV Preps
TypeCollection...pAAV-EF1a-C-CreintG EF1a none 1 Cepko 69916 pAAV.cTNT.iCre cTnT tdTomato 9 Pu 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5... -
Optogenetics + CRISPR, Using Light to Control Genome Editing
TypeBlog Post.... Using the FAST system, Ye’s lab could edit a tdTomato fluorescent reporter gene in mice using Minicircle... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post... vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Trypanosoma cruzi yes, cut S. pyogenes Neo Docampo tdTomato/pTREX-b 68709 Other/Trypanosoma cruzi none S. ... -
Validated gRNA Sequences
TypeCollection...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N... -
Neurodegeneration Plasmid Collection
TypeCollection... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...'s Ophir Shalem 215721 pDual-IN-SMN1 SMN1 GFP, tdTomato CAG Spinal muscular atrophy Chaolin Zhang 216225...