Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 16 of 16 results
  1. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...
  2. Plasmids for Optogenetics Research

    Type
    Collection
    ...ChR2-H134R AAV tdTomato Svoboda 28305 pAAV-FLEX-ArchT-tdTomato Inhibitory ArchT AAV tdTomato Boyden 28307...-CAG-ArchT-tdTomato Inhibitory ArchT AAV tdTomato Boyden 30541 AAV-Flex-rev-oChIEF-tdTomato Excitatory...pAAV-Ef1a-DIO-ChETA-TdTomato-WPRE-pA Excitatory ChETA AAV tdTomato Sabatini 37756 pAAV-Ef1a-DO-ChETA-TdTomato-WPRE-pA...ChrimsonR-tdTomato] Excitatory ChrimsonR AAV tdTomato Boyden 84484 pAAV-CAG-FLEX-rc [Chronos-tdTomato] Excitatory...pAAV-Syn-FLEX-rc [ArchT-tdTomato] Inhibitory ArchT AAV tdTomato Boyden 124231 pTol1-UAS:ChrimsonR-tdTomato Excitatory...Zebrafish tdTomato Bianco 124232 pTol1-UAS:Chronos-tdTomato Excitatory Chronos Zebrafish tdTomato Bianco ...UAS:CoChR-tdTomato Excitatory CoChR Zebrafish tdTomato Bianco 124235 pTol1-UAS:GtACR1-tdTomato Inhibitory...
  3. Control AAV Preps

    Type
    Collection
    ..., PHPeB Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-..., 8, 9, rg* Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHPeB, ...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHPeB,...Deisseroth 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn tdTomato (cytoplasmic), EGFP (presynaptic...dependent 1, 9 Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...
  4. Gradinaru PHP Serotypes

    Type
    Collection
    ...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...pAAV-CAG-GFP CAG GFP Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 104061 CAG-NLS-GFP CAG NLS-GFP...
  5. Optogenetics AAV Preps

    Type
    Collection
    ...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...
  6. Cre-lox system

    Type
    Collection
    ...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus... Mammalian Cepko 69916 pAAV.cTNT.iCre iCre and tdtomato Chicken cardiac troponin T AAV Pu 70120 pEMS2159...inserting promoter none Mammalian Heller 112617 ptdTHC tdTomato and Cre-ERT2 with MCS for inserting promoter none...Cre-ERT2 CAG Mammalian Heller 112621 pCAG-tdTHC tdTomato, Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA...
  7. Retrograde AAV viral preps

    Type
    Collection
    ...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...Flp-dependent Control Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO...Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics Svoboda 26975 pAAV-...
  8. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV....Optogenetics AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Ed Boyden AV-5-PV2527 99039-AAV5 pAAV-CamKII-ArchT-GFP... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP...
  9. Chemogenetics Plasmids

    Type
    Collection
    ...Gi) hDlx tdTomato No Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D (Gq) hDlx tdTomato No Fishell...GFAP Other Reporter/Fusion mCherry IRES-mCitrine tdTomato ChR2 IRES-EGFP Recombinase Cre-dependent Flp-dependent...pAAV-S5E2-Gq-P2A-dTomato hM3D (Gq) E2 Enhancer tdTomato No Dimidschstein 111397 pAAV-hSyn-DIO {hCAR}off...
  10. Church Lab CRISPR Plasmids

    Type
    Collection
    ...GTCCCCTCCACCCCACAGTG 48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG...
  11. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission...
  12. Rett Syndrome

    Type
    Collection
    ...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell...
  13. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...
  14. Validated gRNA Sequences

    Type
    Collection
    ...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N...
Showing: 1 - 16 of 16 results