We narrowed to 32 results for: tdTomato

...pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA AAV9...multiple serotypes pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] AAV5, AAV8 Optogenetics Boyden New serotypes...

...used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus, T-DDOGs can...expression robustly activated the reporter gene TdTomato, whose expression was absent without electroporated...T-DDOGs with two mouse GFP reporter lines; again, TdTomato was seen only in cells with GFP, at a high activation...frequency of 56-93%. In the converse test, 98% of TdTomato expressing cells were GFP+, indicating a robust...

...pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-...fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP... pAAV-hSyn-DIO-mCherry 59462  AAV2  pAAV-CAG-tdTomato (codon diversified) 37825  AAV8*, AAV9*  pAAV-CAG-GFP...

...CsChrimson::tdTomato, an optogenetic tool (CsChrimson) attached to a fluorescent indicator (tdTomato), as the...

...tag neurons activated by opioid withdrawal with tdTomato and assessed cFos expression. She will explore...periaqueductal gray (PAG), with red neurons expressing tdTomato and green neurons expressing cFos. Image from ...

...targeted tdTomato and pre-synaptic targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE...

...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...

...multiple serotypes pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] AAV1 Optogenetics Edward Boyden New serotype ...

... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...

...Roth New serotype pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato AAV8 Molecular tool Massimo Scanziani New viral...

...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

...37825  AAV1 pAAV-CAG-GFP 59462  AAV2 pAAV-CAG-tdTomato (codon diversified) 114472  AAV5, AAV8 pAAV-...

... Edward Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Baljit Khakh 50465 pAAV-hSyn-EGFP...PHP.eB Bryan Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Hongkui Zeng 58909 pAAV-GFAP104...Constitutive 5 Edward Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,... rg* Loren Looger 116870 pAAV-CAG-H2B tdTomato CAG H2B-tdTomato Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH...Maarten Kole 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Guoping Feng... 9, rg* Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...Constitutive 2 Edward Boyden 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Patricia Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...

...promoter Forward tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene...

...ChrimsonR tdTomato Cre dependent 1, 5 Edward Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos tdTomato Constitutive...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Karel Svoboda 75470...ChrimsonR tdTomato Constitutive 1, 5, 9, rg* Edward Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ... 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Edward Boyden 100049...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Patricia Jensen... Edward Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Edward Boyden 50972 AAV-SYP1...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Edward Boyden...

...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...Dimidschstein 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Control Feng 163505 CN1390-rAAV-DLX2.0...

...are available for dual expression of cytoplasmic-tdTomato and Synaptophysin-GFP. Synapse targeting GCaMP6s...

...Cre-dependent Control Bryan Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Edward Boyden 50457 pAAV-hSyn-DIO-EGFP...Control Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Edward Boyden 27056...Control Loren Looger 116870 pAAV-CAG-H2B tdTomato CAG tdTomato Control Loren Looger 24593 AAV-pgk-Cre PGK...Optogenetics Karl Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics Karel Svoboda 26975...

... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals.... Liqun Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato. 8 Massimo Scanziani 34910 paavCAG-pre-mGRASP-...

...usually provided by red fluorescent proteins such as tdTomato or RFP or blue fluorescent proteins like Cyan....