Skip to main content
Addgene

We narrowed to 1,018 results for: REN;

Showing: 381 - 400 of 1018 results
  1. Plasmids 101: Gram Negative and Positive Bacteria

    Type
    Blog Post
    ...in 1983. The differences between gram positive and negative bacteria is due to differences in cell wall...minoring in studio arts photography.  References and resources References Silhavy, TJ., Kahne, D. & Walker ...negative and positive bacteria are permeable to different classes of antibiotics. The classification system...system is incredibly helpful in visualizing differentiations between bacteria, leading to safer medicine...diagnostics/22612-gram-stain Hardy, J. Gram’s Serendipitous Stain. https://hardydiagnostics.com/wp-content...
  2. Screening for Successful Genome Editing with Digital PCR

    Type
    Blog Post
    ...desired mutations. The assays you will use aren’t that much different from conventional duplexed primer probe...mutation of your favourite gene, there are several different methods available. Thankfully, there are many ...primer to amplify the target locus, as well as a reference probe designed to bind at an unedited site distal...are completely “blind” to this very important difference (Figure 3). If you are interested in harnessing... mutations be out of frame! Scott Findlay is currently a Postdoctoral Fellow at the University of Alberta...biology. Follow him on Twitter @AnotherLabRat.     References 1. Miyaoka, Y. et al. Isolation of single-base...
  3. AAV Q&A with Tim Miles

    Type
    Blog Post
    ... the best method for titering AAV? Is there a difference in titer results between ddPCR and qPCR? A: At...curve and somewhat more reliable quantitation. Differences in sample treatment across methods can affect...  Q5: What is the efficiency of co-delivering different AAV particles into the same cells in vivo? A: ...give some insight into codelivery efficiency at different doses. See Figure 4 in this paper for more information...epithelial cells of the blood brain barrier we would currently recommend PHP.V1 or AAV-BR1. We recommend you ...IACUC committee.  Animal Models Q9: Is there any difference in transfection efficiency when delivering these...injections? A: We have not observed any appreciable difference in AAV transduction efficiency between retro-...
  4. CasPEDIA: A Functional Classification of Cas Enzymes

    Type
    Blog Post
    ...new features to the tool. Resources and References References Adler, B., Trinidad, M., Bellieny-Rabelo...CasID, to help facilitate direct comparison of different enzymes. CasPEDIA is meant to be a constantly ...plasmids containing that enzyme, and embedded in the References lists on every page you can find direct links...design, etc.). With this feature, you can compare different Cas enzymes to make sure you are getting the desired...the winner!).   Fig. 3 – Comparison of different Cas enzymes using CasPEDIA. Adapted from Adler...Phylogeny tool allows users to browse entries by the current phylogenetic nomenclature and discover orthologs...
  5. Viral Vectors 101: Viral Vector Elements

    Type
    Blog Post
    ...discussed are compiled for reference below. Happy virus making!  References and Resources Kulanayake,...promoter and terminator regions and are slightly different in sequence. Both LTRs do share common repeat ...there are bonus components to these vectors that aren’t reflected in the common components outlined above...Adeno-associated virus AAV’s elements are quite different from gamma-retrovirus, but they perform very similar...which allows for altered tropism of AAV to target different tissue or cell types. AAV also requires some back...will outline the common features as well as the differences within their viral elements. Gene expression ...
  6. GCE4All: Making Genetic Code Expansion Accessible

    Type
    Blog Post
    ...spread the word as new protocols come out! References Noren, C. J., Anthony-Cahill, S. J., Griffith, M...incorporation of an unnatural amino acid in translation (Noren et al., 1989). In the late nineties, this was developed... But this focus on development, along with the inherent trickiness of using and optimizing GCE, led to...site-directed mutagenesis, many researchers new to GCE aren’t able to successfully complete their experiments...uncommon to find protocols that require reagents which aren’t broadly or easily available, so you may find yourself... they’d also love scientist interested in, or currently using, GCE to reach out to them and let them know...
  7. Antibodies 101: Monoclonal Antibodies

    Type
    Blog Post
    ...for your experimental needs.     References and resources References Bradbury ARM, Trinklein ND, Thie ...experiments, you may be curious about all of the different kinds of antibodies that are available. One common...monoclonal antibody production. Image created with BioRender.com.   The antibody-producing B cells that are...heterogenous mixture of antibodies that recognize many different epitopes on the same protein - are more likely...impacts the specificity, avidity, and number of different antibodies produced by the hybridoma. Image from... Trimmer JS, Görnemann J, Glanville J, Wolf P, Frenzel A, Wong J, Koh XY, Eng H-Y, Lane D, Lefranc M-P...
  8. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type
    Blog Post
    ... actually surprising to us that there aren’t a hundred different versions of this out there. Addgene: ...Addgene. For more details on the plasmids that are currently available along with detailed protocols, go to...and it’s already looking like it’s making a big difference. We can now look at many more transcription factors... this for tagging any protein in all kinds of different assays, not just transcription factors. The second...cells. It was made artificially. That means you aren’t getting any background or cross-reacting. We’ve... They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any additional tips...
  9. Sequencing Primers

    Type
    Guide
    ... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...
  10. Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

    Type
    Blog Post
    ...use temperature to denature and renature the dsDNA. Upon renaturation, you will generate DNA duplexes ...at how variable Cas9-expression was across the different cells (Figure 3).   Figure 2: Cas9 expression...publication. Pro-Tip: 1. Use multiple gRNAs to target different regions of your gene. I used existing BRAF gRNA...our website. There are a few reasons to target different regions of the gene with multiple gRNAs, but the...comparing the phenotypes of multiple gRNAs. Targeting different regions of the gene is also useful in case the...that would co-migrate on a gel) instead of two different sized digestion products (which could be easier...your way to making new scientific observations. References 1. Rago C, Vogelstein B, Bunz F. Genetic knockouts...
  11. When Fidelity Matters: A frank discussion about ligase fidelity

    Type
    Blog Post
    ... probes, LDR can reliably detect single-base differences. The original creators of this technique visualized.... The structural/mechanistic reason for this differential is not known for certain, but may have to do...Sixteen separate pools were prepared, each with a different complement strand covering all 16 possible NN ...each possible pairing resulted in a product of a different length, with products identifiable and quantifiable... in the enzymology of DNA repair enzymes.     References 1. Shuman, Stewart, and Christopher D. Lima. ...superfamily of covalent nucleotidyltransferases." Current opinion in structural biology 14.6 (2004): 757-...PMC4737175. 22. Liu, Pingfang, Artur Burdzy, and Lawrence C. Sowers. "DNA ligases ensure fidelity by interrogating...
  12. Finding Your Science Policy Path

    Type
    Blog Post
    ... away from the bench, I have worked for seven different organizations in a variety of science policy roles...opportunities. But even through all my roles and my current work as a AAAS Science and Technology Policy Fellow...cultural, and political. Science policy looks differently depending on how and where you pursue it. It ...Action Items:  Start a career journal during your current job and note what makes your heart sing, what makes...information may help you determine what parts of your current job you want to keep or change and can inform your...you do science policy? Just like there are many different types of science policy careers, there are many...NSPN maintains a great resource guide including conferences, societies, and outreach groups. Grab a virtual...
  13. A History of Genome Engineering in Popular Culture

    Type
    Blog Post
    ...perspective of the current. Although genome editing technologies have brought a renaissance in the field of...fiction, was also a trained biologist. This is apparent in his work The Island of Dr. Moreau (1896) where...In the 1960s, Har Gobind Khorana, Marshall W. Nirenberg, and Robert W. Holley cracked the genetic code...TALENs more specificity and a broader substrate preference than the ZFNs.   Genetic Engineering Era: Post...also transcended into the world of SciFi. This is apparent in the use of the word ‘CRISPR’ for anything associated...your research Browse plasmids for base editing References Anzalone AV, Randolph PB, Davis JR, Sousa AA,...pangenesis to the rediscovery of Mendel. Comptes Rendus de l’Académie des Sciences - Series III - Sciences...
  14. Stabilized Bacterial Promoters: Constant Gene Expression at any Copy Number

    Type
    Blog Post
    ...were also tested in different plasmid backbones that varied in size or carried different genes. In these ...promoters incorporate feedback loops such as the incoherent feedforward loop (iFFL). In general, iFFLs use...number. Moreover, gene copy number is affected differently by growth rates when a gene is expressed from...Segall-Shapiro et al. showed nearly no position-dependent differences in gene expression. On the other hand, slow growth...promoters can eliminate variability between the different components. When your pathway needs precise fine-tuning...levels, give these stabilized promoters a try. References 1. Segall-Shapiro, Thomas H., Eduardo D. Sontag...
  15. Antibodies 101: Secondary Antibodies

    Type
    Blog Post
    ... hand and use them to easily test different antibodies or different signaling molecules. Many labs find...proteins are represented in orange. Created with BioRender.com.    How do secondary antibodies work?  ...are readily available conjugated to a number of different signaling molecules. With the direct approach,...possible, or ensure that the primary antibodies are different species and/or isotypes. For highly multiplexed...has introduced new options for increasing signal strength.  For the time being, though, secondary antibodies...generated in goat against rabbit immunoglobulins. References and Resources More resources on Addgene’s blog...
  16. Viral Vectors 101: An Introduction to AAV

    Type
    Blog Post
    ... the retina using viral tools.   References and Resources References Pillay, S., et al. "An essential ...and can be specifically targeted to a number of different cell types even when systemically administered...capsids allow the virus to infect (or not infect) different cell types with some specificity. There are a ...will lose expression quicker than terminally differentiated, non-dividing cells.   Figure 2: ...Goz Ayturk with edits and updates from Addgenies Karen Guerin and Susanna Stroik. Didem Goz Ayturk is a...subretinal injections of neonatal mouse eyes at two different ages." Retinal Degenerative Diseases. Springer...
  17. The Future of Research Symposium Boston 2015

    Type
    Blog Post
    ... What are the current numbers of trainees? Are there too few or too many at different levels? What does...generating too many trainees per PI” “Lack of awareness about how the system operates and functions” “...and outside of academic research (4). There are currently 17 sites around the USA undertaking BEST programs...a young scientist’s perspective, and the many different paths that biomedical graduates take in their ...policy. Follow David on Twitter @driglar.     References 1. Alberts, Bruce, et al. "Rescuing US biomedical...Henry, and Michael Roach. "Science PhD career preferences: levels, changes, and advisor encouragement."...
  18. Career Coaching for Scientists: Why and Where Do I Find One?

    Type
    Blog Post
    ...wish to improve their current job situation. What can a coach do that is different from an adviser, boss... transition out of the academic sphere into a different meaningful career in science. Supervisors in the...speaking at research institutions and at scientific conferences, I see that few scientists are aware of the benefits...few hours of coaching time can make an enormous difference so don’t assume that this will cost a fortune...specializes in scientist coaching. Always ask for references and follow up with 3-4 to hear about those clients...also a very popular speaker and workshop leader. Lauren Celano of Propel Careers is not a professional ...
  19. Working with Nuclear Receptors

    Type
    Blog Post
    ...than 300 different coactivator proteins individually contribute to cell regulation in a coherent manner.... one of the most successful targets for drugs currently available or being developed to treat a multitude...patterns of nuclear receptors across multiple different tissues in normal and disease states, their circadian...previously uncharacterized cellular roles. In the current phase of NURSA we are seeking to compliment these...our data mining tool, Transcriptomine. We are currently nearing the completion of an 18-month effort to...found in the Datasets and Reagents sections of the current NURSA website. NURSA and Addgene The great progress...
  20. BeHeard Award 2018: Diseases of Glycosylation, Arginine Mutagenesis, & Neural Development

    Type
    Blog Post
    ...life-threatening consequences. They result from defects in different steps in the glycan biosynthetic pathway and have...characterized by a predisposition to severe and recurrent infections along with a mild or exacerbated inflammatory...infection and other pathological conditions. References: Monticelli, M., Ferro, T., Jaeken, J., dos Reis...multi-subunit macromolecular complexes, but a serendipitous discovery led them to investigate the use of... discovered that the in vitro functions of 11 different Arg-mutant enzymes could be rescued by supplementation...diseases caused by Arg-mutant proteins, but there is currently no evidence of Arg-mutant protein rescue in living...from rare diseases arising from Arg mutations. References: Baldwin, Enoch, et al. "Generation of ligand...
Showing: 381 - 400 of 1018 results