Skip to main content

We narrowed to 17 results for: REN;

Showing: 1 - 17 of 17 results
  1. Molecular Biology Reference

    Type
    Guide
    ...Educational Resources Molecular Biology Reference Molecular Biology Reference Jump To: Origins of Molecular Genetics...An electrical current runs through the porous membrane, and the changes in this current are recorded as...Next-generation Sequencing Long-read Sequencing Reference Tables Additional Resources Plasmids are one of... Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal heritable determinant....isolation (purification) and manipulation. With current cloning technology, it is easy to create and modify...to a certain species, tissue, or cell type. The strength of the promoter can control the level of insert...information about promoters, check out our promoters reference page . Selectable Marker Used to select for cells...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...packaging genes. However, they are different viruses and require different isoforms of these packaging components...genes. From an experimental standpoint, the main difference between lentiviruses and gamma-retroviruses is...: Wild-type lentivirus genome. Created with BioRender.com. All retroviruses use the packaging genes gag...systems, due to a wide range of infectivity for different cell types (known as tropism). Lentiviral vectors...safety. These improvements have been divided into different generations. Lentiviral Generations First-generation...While the viral components are still separated on different plasmids, the viral genome remains largely intact...First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation lentiviral...
  3. Optogenetics Guide

    Type
    Guide
    ...reduces photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/...outside of the brain, rendering the experimental procedure less invasive. Different activation wavelengths... Opsins Optical Switches Plan Your Experiment References The field of optogenetics integrates optics and...naturally occurring microbial opsins that respond to different wavelengths of light, like blue or yellow light...light. These various opsins also initiate different electrochemical responses, such as nonspecific cation...optimization, and chimeric fusion of domains from two different ChRs. These ChR variants still function as light-gated...neuron. Feature enhancements include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ...
  4. Plan Your Experiment

    Type
    Guide
    ...many different Cas proteins available, and researchers can adapt these experiments for different organisms...experiment. Created with BioRender.com. Select Your Desired Genetic Manipulation Different genetic manipulations...Activation/interference Needs good primer design Western blot Knockouts Activation/interference Needs a ...Expression and Delivery Validate Genetic Edit References CRISPR ( C lustered R egularly I nterspaced S...have expanded the CRISPR toolbox to include many different types of edits, including point mutations, base...manipulations require different CRISPR components. Selecting the genetic manipulation you plan to perform will...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central...Figure 1: Wild-type AAV genome. Created with BioRender.com. AAVs are part of the Dependoparvovirus genus...and Cap regions are supplied in trans , via a different plasmid. In order to produce rAAV vectors, three...required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning Cloning your ...with plasmids, visit Addgene’s Molecular Biology Reference . Production The three production plasmids (transfer...Overview of rAAV vector production. Created with BioRender.com. Genome Integration Recombinant AAVs are generally...Serotypes are determined by naturally occurring differences in the variable regions of the virus capsid. ...
  6. Antibody Guide

    Type
    Guide
    ...heavy chain constant region” or Fc. Different isotypes play different roles in the immune response, and ...of colors activated by different wavelengths, allowing for easy differentiation between multiple antibodies...roughly fifty different fluorophore colors in flow cytometry, but the largest panels used currently are in the...Antibodies are typically produced in one of three different methods: in animals, in cultured immune cells,...contain two Fab fragments, each recognizing a different epitope, bound by short peptide linkers. Diabodies...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ...chemiluminescent reaction in the presence of several different substrates. The luminescence produced by the reaction...
  7. Chemogenetics Guide

    Type
    Guide
    ...Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal...RASSLs DREADDs PSAMs LMOs Plan Your Experiment References Chemogenetic tools are actuators for specific... of chemogenetic receptors. There are several different types of DREADDs that can be broadly classified...releases intracellular calcium stores. There are currently three Gq DREADDs based on human muscarinic receptors...cyclase and downstream cAMP production. There are currently two Gi DREADDs based on human muscarinic receptors...increasing intracellular cAMP concentrations. There is currently one Gs-DREADD, rM3D, that was created by replacing...intracellular region of a turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This...
  8. Adenovirus Guide

    Type
    Guide
    ... (A to G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain...reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the Adenoviridae family.... These genes are now supplied in trans , via different plasmids or the packaging cell line, which not...First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors Second-generation...Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors Third-generation...rAdV vectors and helper virus. Created with BioRender.com. Adenoviral Vector Production Cloning Cloning...with plasmids, visit Addgene’s Molecular Biology Reference . AdEasy™ AdEasy™, developed by Bert Vogelstein...
  9. CRISPR Guide

    Type
    Guide
    ...created using BioRender.com (Link opens in a new window) . Addgene Website & Blog References Website CRISPR..., A., Herreno-Pachón, A., Benincore-Flórez, E., Karunathilaka, A., & Tomatsu, S. (2024). Current strategies...Alternatives Resources Plan Your Experiment Web References PAM Sequences Glossary Publications CRISPR Overview...mutation within the targeted gene. However, the strength of the knockout phenotype for a given mutant cell... into high fidelity Cas9s (hfCas9) . There is currently no defined measure of fidelity, so sometimes they...pyrimidine-to-pyrimidine) Base transversions — edit to different classification of nucleotide base (purine-to-pyrimidine...genetic changes, including moving entire genes to different locations, by combining other gene editing mechanisms...
  10. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...packaging genes. However, they are different viruses and require different isoforms of these packaging components...type. From an experimental standpoint, the main difference between lentiviruses and gamma-retroviruses is...-type gamma-retrovirus genome. Created with BioRender.com. All gamma-retroviral vectors use the common... gene, due to a wide range of infectivity for different cell types (known as tropism). Figure 2: Gamma-retroviral...Gamma-retroviral plasmids. Created with BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning...with plasmids, visit Addgene’s Molecular Biology Reference . Production Using HEK293T Gamma-retroviral vectors...flexibility to pseudotype gamma-retrovirus using different envelopes to modify tropism, as the env gene can...
  11. Molecular Cloning Techniques

    Type
    Guide
    ...Learn about different molecular cloning techniques, focusing on seven common cloning methods....Educational Resources Molecular Biology Reference Molecular Cloning Techniques Molecular Cloning Techniques...availability of starting materials, or just personal preference. Check out our blog on choosing the right cloning...insert) into a plasmid backbone. Created with BioRender.com. Gateway Recombination Cloning Gateway cloning... entry , and Gateway destination vectors with different promoters, tags, selection markers, and fluorescent...2: Summary of Gateway cloning. Created with BioRender.com. TOPO Cloning Toposiomerase-based cloning, often...cloning. TOPO = topoisomerase I. Created with BioRender.com. Gibson Assembly (Isothermal Assembly Reaction...
  12. Promoters

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Promoters Promoters Prokaryotic Promoters Eukaryotic...promoter region during transcription. Created with BioRender.com. DNA sequences called response elements are ...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Figure 2. Basic structure...TSS = transcription start site. Created with BioRender.com. Operons Although bacterial transcription is...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter...Figure 3: Lac operon regulation. Created with BioRender.com. Common Bacterial Promoters Researchers often...
  13. Modular Cloning Guide

    Type
    Guide
    ... Molecular Biology Reference Molecular Cloning Techniques MoClo Guide Modular...efficient method for creating many plasmids from different combinations of a common set of components (Weber...including constitutive promoters, T7 expression, RBS strength variants, synthetic terminators, protein purification...plasmids including 11 inducible promoters, 16 RBS strength variants, 8 tag-compatible RBSs, 2 secretion tags...reconstituting the ubiquitination cascades of different organisms in E. coli . MetClo DNA Assembly Kit... for creating fusion proteins for use in many different model organisms. Diatom uLoop Assembly Kit Other...including diatoms, yeast, plants and bacteria. References and More Resources Guide to DNA Assembly Techniques...
  14. Guide to Using Pooled Libraries

    Type
    Guide
    ...pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the... library from the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using... = next-generation sequencing. Created with BioRender.com. Types of Pooled Library Screens In pooled library...responsibility of the researcher. Created with BioRender.com. Both positive and negative screens follow the...
  15. Sequencing Primers

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence... Forward Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC...
  16. Science Guides

    Type
    Guide
    ...Pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the...Find educational guides to learn more about the different types of viruses that are commonly used in research...
  17. Addgene's eBook Collection

    Type
    Guide
    ...Not sure where to start? Need a quick reference? Addgene's eBooks are here to help!...Collection Not sure where to start? Need a quick reference? Addgene's eBooks are here to help! 0 of 0 Selected...
Showing: 1 - 17 of 17 results