We narrowed to 16 results for: REN;
-
TypeGuide...Educational Resources Molecular Biology Reference Molecular Biology Reference Jump To: Molecular Biology Basics...Addgene's molecular biology reference guide, including information on molecular genetics, plasmids, sequencing...verification Resources Genetic Code Webpage and Blog References Protocols Origins of Molecular Genetics The concept... Joshua Lederberg coined the term plasmid, in reference to any extrachromosomal heritable determinant....cells contain the same genetic information as the parental cell, and are thus termed clones of the original...molecular biologist’s toolbox. To learn more about different types of cloning methods check out our guide on...promoter (e.g., a liver-specific promoter). The strength of the promoter is also important for controlling...
-
Lentiviral Vector Guide
TypeGuide...packaging genes. However, they are different viruses and require different isoforms of these packaging components...genes. From an experimental standpoint, the main difference between lentiviruses and gamma-retroviruses is...: Wild-type lentivirus genome. Created with BioRender.com. All retroviruses use the packaging genes gag...systems, due to a wide range of infectivity for different cell types (known as tropism). Lentiviral vectors...safety. These improvements have been divided into different generations. Lentiviral Generations First-generation...While the viral components are still separated on different plasmids, the viral genome remains largely intact...First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation lentiviral... -
Optogenetics Guide
TypeGuide...reduces photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/...outside of the brain, rendering the experimental procedure less invasive. Different activation wavelengths...Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics integrates...naturally occurring microbial opsins that respond to different wavelengths of light, like blue or yellow light...light. These various opsins also initiate different electrochemical responses, such as nonspecific cation...optimization, and chimeric fusion of domains from two different ChRs. These ChR variants still function as light-gated...neuron. Feature enhancements include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ... -
Plan Your Experiment
TypeGuide...many different Cas proteins available, and researchers can adapt these experiments for different organisms...experiment. Created with BioRender.com. Select Your Desired Genetic Manipulation Different genetic manipulations...Activation/interference Needs good primer design Western blot Knockouts Activation/interference Needs a ...Expression and Delivery Validate Genetic Edit References CRISPR ( C lustered R egularly I nterspaced S...have expanded the CRISPR toolbox to include many different types of edits, including point mutations, base...manipulations require different CRISPR components. Selecting the genetic manipulation you plan to perform will...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused... -
Adeno-associated virus (AAV) Guide
TypeGuide...2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central...Integration AAV Types Common Uses Safety Resources and References Plasmid Elements Glossary Adeno-Associated Viruses...Figure 1: Wild-type AAV genome. Created with BioRender.com. AAVs are part of the Dependoparvovirus genus...and Cap regions are supplied in trans , via a different plasmid. In order to produce rAAV vectors, three...required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning Cloning your ...with plasmids, visit Addgene’s Molecular Biology Reference . Production The three production plasmids (transfer...Overview of rAAV vector production. Created with BioRender.com. Genome Integration Recombinant AAVs are generally... -
Antibody Guide
TypeGuide...heavy chain constant region” or Fc. Different isotypes play different roles in the immune response, and ...of colors activated by different wavelengths, allowing for easy differentiation between multiple antibodies...roughly fifty different fluorophore colors in flow cytometry, but the largest panels used currently are in the...Antibodies are typically produced in one of three different methods: in animals, in cultured immune cells,...contain two Fab fragments, each recognizing a different epitope, bound by short peptide linkers. Diabodies...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ...chemiluminescent reaction in the presence of several different substrates. The luminescence produced by the reaction... -
Chemogenetics Guide
TypeGuide...Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal...RASSLs DREADDs PSAMs LMOs Planning Your Experiment References Chemogenetic tools are actuators for specific... of chemogenetic receptors. There are several different types of DREADDs that can be broadly classified...releases intracellular calcium stores. There are currently three Gq DREADDs based on human muscarinic receptors...cyclase and downstream cAMP production. There are currently two Gi DREADDs based on human muscarinic receptors...increasing intracellular cAMP concentrations. There is currently one Gs-DREADD, rM3D, that was created by replacing...intracellular region of a turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This... -
Adenovirus Guide
TypeGuide... (A to G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain...Adenoviral Types Common Uses Safety Resources and References Plasmid Elements Glossary Adenoviruses (AdV) ...reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the Adenoviridae family.... These genes are now supplied in trans , via different plasmids or the packaging cell line, which not...First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors Second-generation...Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors Third-generation...rAdV vectors and helper virus. Created with BioRender.com. Adenoviral Vector Production Cloning Cloning... -
CRISPR Guide
TypeGuide...created using BioRender.com (Link opens in a new window) . Addgene Website & Blog References Website CRISPR..., A., Herreno-Pachón, A., Benincore-Flórez, E., Karunathilaka, A., & Tomatsu, S. (2024). Current strategies...Alternatives Resources Plan Your Experiment Web References PAM Sequences Glossary Publications CRISPR Overview...mutation within the targeted gene. However, the strength of the knockout phenotype for a given mutant cell... into high fidelity Cas9s (hfCas9) . There is currently no defined measure of fidelity, so sometimes they...pyrimidine-to-pyrimidine) Base transversions - edit to different classification of nucleotide base (purine-to-pyrimidine...genetic changes, including moving entire genes to different locations, by combining other gene editing mechanisms... -
Gamma-Retroviral Vector Guide
TypeGuide...packaging genes. However, they are different viruses and require different isoforms of these packaging components...type. From an experimental standpoint, the main difference between lentiviruses and gamma-retroviruses is...-type gamma-retrovirus genome. Created with BioRender.com. All gamma-retroviral vectors use the common... gene, due to a wide range of infectivity for different cell types (known as tropism). Figure 2: Gamma-retroviral...Gamma-retroviral plasmids. Created with BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning...with plasmids, visit Addgene’s Molecular Biology Reference . Production Using HEK293T Gamma-retroviral vectors...flexibility to pseudotype gamma-retrovirus using different envelopes to modify tropism, as the env gene can... -
Cloning
TypeGuide...you to do many different molecular biology techniques (such as fusing it with different tags, putting ...Addgene's reference guide on molecular cloning techniques, including information on seven commonly used... Molecular Biology Reference Choosing a Molecular Cloning Technique Molecular Cloning...availability of starting materials or just personal preference. Check out our blog on choosing the right cloning...Gateway® destination plasmids have been made with different promoters, tags and fluorescent proteins. Thus... variety of promoters and into backbones with different selection cassettes). Although gateway cloning...base pairing in the annealed product, ligation is rendered unnecessary. The product may be transformed directly... -
Promoters
TypeGuide... Plasmid Reference Molecular Biology Reference Promoters Promoters Definition A promoter is...Addgene's molecular biology reference material covering promoters, transcription and the transcription...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Operons Although bacterial...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter... types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes encoding... -
Sequencing Primers
TypeGuide... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC... -
Science Guides
TypeGuide...Pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the...Find educational guides to learn more about the different types of viruses that are commonly used in research... -
Guide to Using Pooled Libraries
TypeGuide...pooled libraries are single preparations of many different plasmids. Plasmids within a given library have...the same backbone, but they express or target different genes. Some libraries cover the majority of the... library from the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using... -
Addgene's eBook Collection
TypeGuide...you're not sure where to start or need a handy reference, Addgene's eBooks are here to help!...you're not sure where to start or need a handy reference, Addgene's eBooks are here to help! 0 of 0 Selected...