Skip to main content
Addgene
Showing: 381 - 400 of 653 results
  1. Deciphering the Mysteries of Behavior with Viral Vectors

    Type
    Blog Post
    ...of these neurons via the channel Channelrhodopsin 2 (ChR2) reduced glutamate transmission from the mPFC...deliver Cre-dependent expression of  Channelrhodopsin 2 (ChR2), a modified receptor protein that activates...have made great strides to map brain regions and allocate specific functions to them. Electrical recordings...long-lasting antidepressant effects." Nature communications 10.1 (2019): 223. PubMed PMID: 30644390. PubMed...
  2. Retrograde AAV viral preps

    Type
    Collection
    ...Calcium sensor Ting 83899 pAAV-mDlx-GCaMP6f-Fishell-2 mDlx GCaMP6f expression under the control of the mDlx...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
  3. Supporting Reproducibility with a Connected ELN

    Type
    Blog Post
    ...connectivity to other data sources used in research; (2) connectivity to other tools used in research; and...by making it easy to get data out of the ELN; and (2) facilitate inter-operability with other research ... both accept deposit of data associated with publications into one of five general purpose open source...
  4. Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

    Type
    Blog Post
    ... both substantial merit and national importance; (2) The foreign national must be well positioned to advance...outstanding achievements in your specific academic field, (2) that you have three 3 years of research experience..., Casseus Law suggests a mix of experts including 2 dependents –people who have worked with you i.e. your...higher education nonprofit entities related to or affiliated with institutions of higher education nonprofit...for self-sponsorship of the I-140 application meaning that the category does not require a foreign national.... NIW requirements stress “educational background, expertise, publications, and plan for future activities...received 116,224 employment based green card applications and approved 91,023 during the first 3 quarters...
  5. 5 Reasons to Use Reddit for Science Communication

    Type
    Blog Post
    ...community is active, engaged, and has great questions! 2. The r/Science subreddit is well moderated. One of...re more interested in selling a product than communicating your ideas with people or discussing science...to write about in the future. The AMA was also cataloged for permanent reference by the Winnower. The only...I do a lot of public speaking where I enjoy communicating face to face with the audience. I post on LinkedIn...own expertise and your resources for science communication opportunities like an AMA. One of the best things... science communication...
  6. Twenty Years of Sharing: Addgene's Viral Vector Service

    Type
    Blog Post
    ...their payload to.   Figure 2: Numbers of AAV tools, by category, available from Addgene as of 2023... (Figure 2). Biosensors, which include calcium and voltage sensors, are the broadest category of viral...in 2018. By the end of 2023, our catalog had grown to 879 viral catalog items (Figure 1). The service caught...repository. GCaMP, a calcium indicator (biosensor, by Addgene’s categorization) was first developed in 2001...number of requests for vectors in the “controls” category, which includes things like viral vectors that...capsid of the AAV, many of the vectors in Addgene’s catalog are offered in different serotypes. In fact, the...are the most requested serotypes (Figure 4), our catalog includes vectors in a variety of serotypes, including...
  7. Using Video to Share Your Science: We Share Science

    Type
    Blog Post
    ...Journal of Librarianship and Scholarly Communication 2.2 (2014): 2. Additional Resources on the Addgene ...Information Science and Technology 60.4 (2009): 858-862. 2. Van Noorden, Richard. "Interdisciplinary research...be part of the answer. Problems with written publications Online tools like ResearchGate, GoogleScholar... that the big breakthroughs in my discipline, education, will come from ideas garnered from research in...from the science of others. Improving science communication through video     Video abstracts about research... to be that video is the future in terms of communicating ideas. In 2012, for example, 3 billion hours...scientific videos were for entertainment or basic education (i.e., learn why water freezes) there was a growing...
  8. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...and open a new conversation about GMOs.  Challenge #2: Technical obstacles to plant synthetic biology In...biotechnologists face is public perception of genetic modification (GM) and synthetic biology. The mistrust and...cannot build what we do not understand, and the complicated and unique metabolic processes of plants are ...
  9. pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs

    Type
    Blog Post
    ...blood are reprogrammed immediately after collection [2]. PBMCs display unique epigenetic signatures that ...PMID: 27882265. PubMed Central PMCID: PMC5118044. 2. Kim, Y., et al., The Generation of Human Induced ... OriP and induces amplification of the episomes concurrently with DNA amplification in the host cell. ...possibilities for the clinical and therapeutic applications of iPSCs. The generation of human iPSCs (hiPSCs...hiPSCs, reprogramming methods that do not involve modification of the original genome by integrating viral ...where each vector contains a viral origin of DNA replication, OriP and the EBNA-1 sequence that encodes for...are necessary and sufficient for retention and replication of the vectors in human cells [8]. The EBNA-1...
  10. CRISPR 101: Which Cas9 Do I Choose for My CRISPR Experiment?

    Type
    Blog Post
    ...sequence is unique compared to the rest of the genome.  2) The target is present immediately upstream of a Protospacer...utilized allowing for PAM flexibility. Fig. 2: Prime editor engaging target DNA. The reverse transcriptase... than ever to make precise, targeted genome modifications. Cas9 has been modified to enable researchers...instead.  Choosing a Cas9 for site-specific modifications Site-specific deletions and knockouts Some experiments...mutation at a specific site e.g., deleting the catalytic residue of a protein or knocking out a very small...flexibility as to where your sgRNA needs to be located and there may not be a NGG PAM site anywhere to... Beyond SpCas9.” Single base pair edits Is the location and type of edit you need to introduce highly ...
  11. Inntags: Innovative Protein Epitope Tagging

    Type
    Blog Post
    ...tagging." Nature methods (2015). PubMed PMID:26322837. 2. Stadler, Charlotte, et al. "Immunofluorescence and...immunoprecipitation applications, but none of the traditional tags were suitable for both applications. To prove...from non-vertebrate systems. Preliminary testing indicated that inntags IT5, IT6, and IT10 expressed well...and the chaperone Ydj1, both of which display sophisticated interactions with multiple other proteins. Again...detrimental effects on cell size and growth rate, indicating that they compromised protein-protein interactions...These tags are easy to use in multiple common applications. Due to their limited effects on native protein...particularly in single-molecule or high-throughput applications. Perhaps IT5 and IT6 will even replace our older...
  12. The Addgene Antibody Data Hub

    Type
    Blog Post
    ...whether the results include knockout data.    Figure 2: Search options in the Antibody Data Hub. Data reports...very little data on which might work in your application. It can be quite difficult to decide on which...be searched and sorted by gene/target, name, application, pass/fail rating, sample species, antibody species... how the antibody performed in the submitted application, along with a brief description of the experiment...experiment. If that data was included in a publication, you'll find that information in the report as well... section will vary slightly depending on the application — flow cytometry, western blot, immunohistochemistry...data showing how the antibody worked in your application. The submission process is easy, with simple,...
  13. Addgene's Website Update

    Type
    Blog Post
    ...prompt you to log in or create an account.  Figure 2: The new deposit materials bar New menu Most common...and easily navigate to educational resources, tools, collections in our catalog, and the Addgene Help ...search bar. And if you’re in the mood to browse our catalog, you can use the links under the search box to ...scrolling up and down the page.  Figure 3: The Education & Tools menu Further down What happens if you ... mission, links to our deposit, request, and educational resources page, and previews for our three most...
  14. CRISPR 101: Validating Your Genome Edit

    Type
    Blog Post
    ...faster when using a dual guide system.   Fig. 2: Size screening for large deletion events.   ... Biol 17: https://doi.org/10.1186/s13059-016-1012-2 Find more CRISPR Resources at Addgene: Read our CRISPRGuide...how many copies you are looking for. Secondly, categorize your edit – is it any frameshift mutation? A ...enzyme screening for resistivity to digestion, indicating targeted edits.   Interested in this method...a manageable number of the higher probability locations. If you’re worried about off-target effects, you...Tao Chen, Jos Jonkers, Bas van Steensel. Easy quantification of template-directed CRISPR-Cas9 editing. (...and variant-aware in silico off-target site identification for CRISPR genome editing. (2019) Bioinformatics...
  15. Proximity Labeling: A Powerful Tool for Protein Complex Purification and Proteomic Mapping

    Type
    Blog Post
    ...There are approximately 2-4 million proteins per cubic micron in bacteria, yeast, and mammalian cells...scientists have long used antibody based affinity purification and mass spectrometry approaches. Recently however...that are tagged with biotin using avidin coated purification techniques. Due to the high affinity of biotin...challenge for classic antibody based affinity purification/mass spectrometry methods.  BioID: a promiscuous...can even target BirA* to specific subcellular locations, such as the nuclear envelope, allowing scientists...scientists to probe interactions in locations of interest.  Try BioID for your proximity labeling experiment... proximity labeling (Rhee et al., 2013). APEX catalyzes the oxidation of biotin-phenol to the short-lived...
  16. Synthetic Biology, Artificial Chromosomes, iGEM & More - Interview with Tom Ellis

    Type
    Blog Post
    ...balance in Academia. Will it all pay off? Chapter 2: The Centre for Synthetic Biology and Innovation -...foundational research, training, startups, and real applications of SynBio. Chapter 3: Synthetic biology as the...synthetic genome project and constructing ever more complicated biological devices. Chapter 6: - Making research...Addgene Blog Learn about the Synthetic Biology Education Nonprofit BioBuilder Plasmids 101: Golden Gate...
  17. 500,000 Plasmids Shipped and Counting!

    Type
    Blog Post
    ...at Addgene – 500,000 plasmids shipped! That's a 1/2 million plasmids sent to happy scientists around the...office – previously at 1 Kendall Square, but newly relocated to 75 Sidney Street. Then the plasmids travel ... thank you. 500,000x Thank You! Addgene's new location: 75 Sidney St, Suite 550A, Cambridge, MA 02139...
  18. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...extraction solution, runs the protocol, then uses around 2-4ul in each 50ul PCR reaction. The gDNA extracted ... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...
  19. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...double strand break), increasing editing efficiencies 2-3-fold. However, the process of double nicking increases... editing as efficient as possible. Figure 2: Decision tree for selecting a PE6 variant. PE = prime...using paired prime editing. Nature Biotechnology, 40(2), 218–226. https://doi.org/10.1038/s41587-021-01025... the indicated tool. ~ reflects an innovation that may optionally be combined with the indicated tool....genetic variants have been identified in humans and cataloged in the ClinVar database. Previously developed ...prime editing Less constrained by PAM sequence location The prime editor extends the reach of CRISPR genome...editing typically needs to be optimized for each application, and the efficacy varies widely — it still almost...
Showing: 381 - 400 of 653 results