Skip to main content

We narrowed to 38 results for: cat.2

Showing: 1 - 20 of 38 results
  1. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...phosphate monobasic monohydrate (NaH 2 PO 4 ∙H 2 O), pH 7.0 138 g NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust...sodium phosphate dibasic (NaH 2 PO 4 ), pH 7.0 142 g of NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH...monobasic monohydrate (NaH 2 PO 4 ∙H 2 O) 610 mL of sterile sodium phosphate dibasic (NaH 2 PO 4 ) Store up to...recombinant antibody. Section 2: Buffer exchange Choose Option 1 or Option 2 based on the concentration ...antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment Class II, Type...conical tubes NanoDrop spectrophotometer 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 ... channel pipette 20–200 µL single channel pipette 2–20 µL single channel pipette Reagents Aspirating pipette...
  2. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ... column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer exchange and concentration...) . Figure 2: Left panel: Iodixanol gradient after ultracentrifugation. The arrow indicates the 60–40%...7.4 1X PBS-MK buffer 100X Poloxamer 188 NaCl MgCl 2 KCl Centrifugal filter units (MWCO 100 kDa) Reagent...PBS-MK buffer Dissolve 5.84 g of NaCl, 26.3 mg of MgCl 2 and 14.91 mg of KCl in 1× PBS in a final volume of...at 4 °C. 1X PBS-MK buffer Dissolve 26.3 mg of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume ...(C) (formulation buffer) Add 5 mL of Buffer B and 2 mL of 5 M NaCl to 43 mL PBS Procedure Preparation ...need more time, you can alternatively centrifuge for 2 h at 200,000 x g at 18 °C. Carefully take the QuickSeal...
  3. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ... 10 90 2 x 10 8 10 of 2 x 10 8 dilution 90 2 x 10 7 10 of 2 x 10 7 dilution 90 2 x 10 6 10 of 2 x 10 6...6 dilution 90 2 x 10 5 10 of 2 x 10 5 dilution 90 2 x 10 4 10 of 2 x 10 4 dilution 90 2 x 10 3 Pro-Tip...dilutions, in duplicate, of your standard curve plasmid (2 x 10 9 stock made in step #1): Volume of 2 x 10 9 ...molecules/μL To obtain a solution at 2 x 10 9 molecules/μL: 1.59 x 10 11 / 2 x 10 9 = 79.8X dilution ...stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution 3 20 uL Dil. 2 80 uL 5X 1000X Dilution ...valid 8-point standard curve. Figure 2: Example of the amplification plots obtained from an AAV sample. ...PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal...
  4. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...PCR tube Ice Bucket 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 ... reagents on ice): 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 ...normally sterile dH 2 O. To make a 100uM stock of any primer, add a number of µl of dH 2 O equal to the number...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can ...(PCR). Basic PCR Program Initial Denaturation for 2 minutes at 94°C: This initiation step heats the double...target DNA strand accurately and rapidly. Repeat steps 2-4 25-30 times. Final Extension for 5 minutes at 72...
  5. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...worn outside of the BSL-2 area. BSL-2 laboratories must be clearly marked as “BSL-2.” The names and contact... biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of the four levels is to distinguish...in addition to BSL-2 guidelines below, including PPE protocols . Working in a BSL-2 laboratory requires... steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...humans, for example, non-pathogenic E . coli . BSL-2 is for labs that work with pathogens including organisms...as Staphylococcus aureus or Vibrio cholerae . BSL-2 includes all of the precautions needed in BSL-1, along...
  6. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...materials D.2 Screening for inserts E. Producing Lentiviral Particles E.1 Recommended materials E.2 Protocol...Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty...VWR: #7177-48-2. Use at 100 μg/mL. Carbenicillin VWR: #80030-956. Use at 100 μg/mL. C.2 Annealing Oligos...oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate for 4 minutes at 95°C in a PCR machine...buffer 1 1 μL AgeI add ddH 2 O to bring to 50 μL final volume Incubate at 37°C for 2 hours. Purify with Qiaquick...buffer for EcoRI 1 μL EcoRI 14 μL ddH 2 O Incubate at 37°C for 2 hours. Run digested DNA on 0.8% low melting... For a standard T4 ligation, mix: 2 μL annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning ...
  7. AAV Production in HEK293 Cells

    Type
    Protocol
    ...430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269, 1272 cm 2 Heat-inactivated...: 50 mM Tris HCl, 150 mM NaCl, 2 mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working... mL of PBS. Aspirate PBS and add 2 mL of 0.05% Trypsin/EDTA. Wait ~2 min. Neutralize trypsin by adding...Cell-Stack (CS5) (Link opens in a new window) (3,180 cm 2 - the same surface area as 21 x T-175 flasks). Cell...flasks. Workflow Timeline Day 0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...
  8. Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs

    Type
    Protocol
    ...level 1 (BSL-1) and biosafety level 2 (BSL-2). The BSL-1 classification is for labs working with low-risk...BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Personal ...Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more protocols ...individuals from potential accidents such as spills. BSL-2 is different because it includes labs that work with...agents associated with diseases in healthy humans. BSL-2 includes all of the precautions needed in BSL-1, however...and/or face shields can be used as needed. For BSL-2 work always wear glasses/goggles in addition to the...
  9. Lentivirus ddPCR Titration

    Type
    Protocol
    ...Activation 95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold ...diploid cells, thus the reason for multiplying by 2. $$V = 2*{copies\ RRE \over copies\ RPP30}$$ Use the viruses...diluted 2-fold serially, the concentration of RRE positive droplets should decrease by a factor of 2 across...Lentivirus is generally considered biosafety level 2+. Please ensure that you are in compliance with your...channel pipette 200–1000 µL single channel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...Detach cells by incubating with 200 µL TrypLE for 1–2 min. Resuspend cells in 500 µL DMEM complete and transfer... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...
  10. General Transfection

    Type
    Protocol
    ... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high... for viral production) Day 1: Transfect Cells Day 2 (am): 18 h post transfection - Remove media, replace...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container... use. Thawed aliquots should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000...times a week: Monday: Plate 1x10 6 cells in a 75 cm 2 flask in a volume of 15 mL. Wednesday: Plate 1x10 ...
  11. Lentivirus Production

    Type
    Protocol
    ... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working...μg total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided...packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection. Remove media, replace...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...culture plates. Incubate the cells at 37 °C, 5% CO 2 for ~20 h. Prepare a mixture of the three transfection...plasmid using a variety of ratios. Check the cells 1-2 days after transfection to determine what ratio gives...
  12. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...follows: Figure 2 Using the box tool, draw a box around the entire first gel lane (as in Figure 2). Select Analyze... Example for AR0018 (lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 (HC)...choose Use Equation . Select the Show R 2 checkbox. Pro-Tip The R 2 of the trendline should be between 0.95...Equipment Heat block 1–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... Add 5 µL of 4X sample buffer to each sample. Add 2 µL 10X reducing agent to each sample. Spin the sample...bottom part of the gel where dye is visible. Section 2: Staining the Gel Place the gel in a plastic tray .... Figure 1 Recombinant antibody preps should have 2 clear bands at ~50 kDa and ~25 kDa corresponding to...
  13. AAV ddPCR Titration

    Type
    Protocol
    ... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...
  14. Western Blot

    Type
    Protocol
    ...transfer, block, incubate with primary antibody Day 2: Incubate with secondary antibody Video Watch this... Microcentrifuge 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...Heat block Mini gel tank chamber Power supply iBlot 2 Gel Transfer Device Roller Spatula Platform shaker...running buffer Prestained protein ladder Ethanol iBlot 2 PVDF Mini Stack, Thermo Fisher IB24002 20X TBS Tween...immediately or store at -80 °C until ready to use. Section 2: Determine the total protein concentration and prepare...in deionized water. To prepare 20% ethanol, dilute 2 mL of ethanol into 8 mL of deionized water and mix...the transfer sandwich as follows: Unseal the iBlot 2 PVDF Mini transfer stack. Set the Top Stack to one...
  15. Fluorescence Titering Assay

    Type
    Protocol
    ...method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over V_T}$$ Where: T = Titer...downstream applications. Safety Warnings Lentivirus is generally considered biosafety level 2+. Please ...Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace with fresh media Day 4...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...complete. Mix well by pipetting or inverting. Aliquot 2 mL of cell suspension into each well of the 6-well...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...
  16. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo...
  17. CRISPR Library Amplification

    Type
    Protocol
    ... recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed at the... day to ensure that growth times are limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 ... Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate transformations...has been absorbed by the agar. This usually takes 1-2 minutes. Critical Be careful not to rip or shred the...incubation if needed. Place 100 mL sterile LB at 4 ℃. Day 2 (morning) Before beginning, prechill at least four...pellet. The total weight of each pellet should be ~1-2 g. Pro-Tip Make sure to weigh the empty tube beforehand... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...
  18. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...vapors. Workflow Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody incubation Day 4...with 96-well plates 1–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...serial dilutions of the purified antigen as follows: 2 ng/µL : Add 100 µL of 20 ng/µL stock into 900 µL PBS...microfuge tube and vortex. 1 ng/µL : Add 450 µL of 2 ng/µL stock into 450 uL PBS in a microfuge tube and...37 °C for 30 min , or overnight at 4 °C . Section 2: Block the plate Prepare the wash buffer (0.05% Tween...incubate on a microplate shaker set to 400 rpm for 2 h at room temperature or overnight at 4 °C . Section...
  19. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH 2 O to 400 mL Note: If your lab has pre-mixed...start 2 mL in a Falcon tube. For larger preps, you might want to use as much as a liter of LB in a 2 L Erlenmeyer...antibiotic. Unless otherwise indicated, the antibiotic powder can be dissolved in dH 2 0. Addgene recommends ...individual plasmid within a single bacterial cell (Figure 2). Large plasmids usually have a low copy number (approximately...determine if your plasmid is high or low copy. Figure 2: High versus low copy plasmids in bacteria. Created...
  20. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...Warnings HEK293 cells are considered biosafety level 2. Please ensure that you are in compliance with your... 18, 2022 Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest...conical tubes Automated cell counter 37 °C, 5% CO 2 incubator with shaking platform set to 120 rpm 37 ...250 mg Benzamidine 25 mL Aprotinin saline solution (2 mg/mL) Mix well and sterilize through a 0.2 µm PES... a 500 mL vented flask.Incubate in a 37 °C, 5% CO 2 incubator on a shaking platform set to 120 rpm. Pro-Tip... not use cells that are over 30 passages. Section 2: Transfection Check the cell density and viability...the culture. Pro-Tip Culture should be between 1.5–2 x 10 6 cells/mL with >95% viability to proceed with...
Showing: 1 - 20 of 38 results