Skip to main content
Addgene

We narrowed to 1,014 results for: REN;

Showing: 421 - 440 of 1014 results
  1. Treating Muscular Dystrophy with CRISPR Gene Editing

    Type
    Blog Post
    ...disease postnatally. Now, three papers published concurrently in Science have shown CRISPR can treat a genetic... Even low-frequency editing could make a huge difference in DMD, and it’s estimated that exon skipping...respectively. Although each study used slightly different methods, they each observed the same positive ...necrosis compared to unedited animals. In grip strength, specific force, and other muscle tests, muscle...disease type C. Although the three DMD studies referenced here represent a great step forward for CRISPR...many distinct CRISPR therapies to match these different mutations. For each therapy, effectiveness and...treatments may also be closer than we might expect.   References 1. Kaiser J. CRISPR helps heal mice with muscular...
  2. Promoters

    Type
    Guide
    ... Plasmid Reference Molecular Biology Reference Promoters Promoters Definition A promoter is...Addgene's molecular biology reference material covering promoters, transcription and the transcription...transcription of DNA into mRNA. Promoter binding is very different in bacteria compared to eukaryotes. In bacteria...promoter region. Each sigma factor recognizes different core promoter sequences. Operons Although bacterial...regulation, like operons. Operons are a cluster of different genes that are controlled by a single promoter... types of RNA polymerases that all transcribe different genes. RNA polymerase I transcribes genes encoding...
  3. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ... for in the future! References Bubeck F, Hoffmann MD, Harteveld Z, Aschenbrenner S, Bietz A, Waldhauer...of Cas9 activity.  The field of optogenetics is renowned for enabling precise temporal and spatial control...CRISPR gene activation system, but settled on a different optimal fusion protein combination. The optimized... C-terminal (residues 714-1368, C714) halves, rendering the Cas9 non-functional when split but regaining...absence of light, Cas9 is bound by AcrIIA4 and rendered inactive. In the presence of blue light, AcrIIA4...Alexander Deiters’ lab, on the other hand, took a different approach. These researchers used a genetically...photoactivatable transcription systems to induce neuronal differentiation. Nat Methods 14:963–966 . https://doi.org/10.1038...
  4. X-CHIME: Context Dependent Germline Knockout in Immune Cells

    Type
    Blog Post
    ...However, many genes have different functions in different cell types, at different times, and in combination...T cell responses to cancer.     References and resources References LaFleur, M. W., Lemmen, A. M., Streeter...combination with different genes. Having CRISPR systems for assessing genes in defined contexts would be quite...
  5. In Living Color: The Skinny on In Vivo Imaging Tools

    Type
    Blog Post
    ... tissues are nearly transparent. As Verkhusha explained it to me, the transparency window of mammalian...tumor. They wanted to find something better. Transparency window That’s exactly what they reported doing...corals, but all of them fluoresce outside the transparency window of mammalian tissues,” Verkhusha said...near-infrared fluorescent proteins within this transparency window, so now, we could see deeper.” Adding...of the time, the answers will be there.     References: Bright and stable near-infrared fluorescent ...
  6. CRISPR 101: Cytosine and Adenine Base Editors

    Type
    Blog Post
    ...Emily P. Bentley in February 2025. References and Resources References Chen, L., Zhu, B., Ru, G., Meng, ...component of the nucleoside inosine. Created with BioRender.com. How does base editing work? Base transition... UGI = uracil DNA glycosylase. Created with BioRender.com. The BE3 system increased editing frequency...APOBEC3G displayed less predictable sequence preferences.  The Liu lab also used natural and engineered...yielded an editor with more flexible sequence preferences, evoAPOBEC1-BE4max, which is significantly more...the development of prime editing, which uses a different mechanism than base editing, has allowed scientists.... A dual-deaminase CRISPR base editor enables concurrent adenine and cytosine editing. Nature Biotechnology...
  7. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ... the transcript. Different Cas orthologues and subtypes function somewhat differently and can be more ...Gram-positive bacteria Jason Peters, Oren Rosenberg, and Carol Gross used two different genetic systems, targeting...Transcriptional repression (CRISPRi) in bacteria As RNA interference does not function in bacteria, most efforts ...Clostridium difficile, could be targeted and preferentially depleted from gut. While still far from the...the BE3 that further improves editing rates. References Bikard D, Euler CW, Jiang W, Nussenzweig PM, ...inMycobacterium tuberculosisusing an efficient CRISPR interference system. Nucleic Acids Res 44:e143–e143 . https...
  8. Viral Vectors 101: AAV Serotypes and Tissue Tropism

    Type
    Blog Post
    ...for contributing their expertise! References and resources References Aschauer, D. F., Kreuz, S., & Rumpel... 1: Diagram of AAV components. Created with BioRender.com. AAV vectors have both distinctive capsids...multiple coreceptors, which may be present on different cell types and sometimes vary between target species...service.  In summary Your choice of AAV vector inherently depends on your experimental system. As we cannot... al., 2021 In addition to tissue tropism, different AAV serotypes can be useful to evade neutralizing...Transfer by Adeno-Associated Virus Vectors via Different Routes. Diabetes, 55(4), 875–884. https://doi....
  9. Sequencing Primers

    Type
    Guide
    ... Plasmid Reference Molecular Biology Reference Sequencing Primers Sequencing Primers...convenience. For reference information, please consult Addgene's Molecular Biology Reference Page . All listed...sequences listed on the left are provided for your reference. Addgene does not distribute primers. For sequencing... hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT...forward primer Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...
  10. Running for Rare Disease, Running for FOP, Running for AJ

    Type
    Blog Post
    ...Swanson a structural biologist and protein engineer currently working at Sanofi Pharmaceuticals in Cambridge... Rare Disorders (NORD). NORD raises money and awareness for rare disease and helps patients find the correct...first met AJ and his family, he did not seem much different than my second son of similar age. When he came...play with my kids like any other youngster. His parents, Kristi and Rico, had to keep him from running ...an organization dedicated to raising funds and awareness of FOP. Please consider running with us or making...is a structural biologist and protein engineer currently working at Sanofi Pharmaceuticals in Cambridge...
  11. Year of the Camelid: Antibody Style

    Type
    Blog Post
    ...the discoveries yet to come.      References and resources References Arbabi-Ghahroudi M (2017) Camelid...Camelids. The declaration is intended to raise awareness of the economic and cultural importance of these...become appealing candidates for the detection of different cancers (Jin, et al. 2023).  So where do all these...mouse-derived single-domain antibodies. Image created in BioRender and adapted from Xu, et al., 2021.   The single-domain...antibody field has come a long way since the serendipitous discovery of heavy-chain only antibodies in ...
  12. Bringing Sustainable Practices to the Lab: Recycling

    Type
    Blog Post
    ...meaningful changes in the lab could make a big difference in our global impact as scientists. Many scientists... boxes Some vendors take back their expanded polystyrene (a.k.a. Styrofoam or cooler boxes). We get these...receiving temperature-controlled reagents. Expanded polystyrene will likely end up in a landfill, but at least...with CO2 emissions. NEB takes back expanded polystyrene boxes for free (in the U.S.). Their cooler boxes... 1976! Millipore Sigma takes back expanded polystyrene boxes for free (in the U.S.). After you receive...Sustainable Practices to the Lab: Easy Action Items References Geyer, Roland, Jenna R. Jambeck, and Kara Lavender...
  13. Cellosaurus: A Cell Line Information Database

    Type
    Blog Post
    ...specific compounds, links to publication references, and cross-references with cell line catalogs and collections...be adjusted based on query, reference, and shared allele search preferences to help you identify proximal...entry.) You can look up the cell lines you are currently or planning to use for helpful information on ...to learn more, check out the Cellosaurus FAQ! References Lorsch JR, Collins FS, Lippincott-Schwartz J....
  14. Interview: Ed Boyden on Optogenetics, Neuroscience, and the Future of Neuroengineering

    Type
    Blog Post
    ...specific problem. Every species is so different – an awake monkey is different from a cell in a dish. I always...want to activate two sets of neurons and see how different parts of the brain or the cells within them work...Boyden: I think because neuroscience has so many different goals: to understand how a mouse changes emotions...find ways to make these tools more selective for different ions. Right now, we can modulate electricity. ... click the link in the Addgene Alerts box. References: Independent Optical Excitation of Distinct Neural...
  15. Why Add Sucrose? Improved Yields for Adeno-associated Virus Preparation

    Type
    Blog Post
    ...redesigning viral packaging plasmids, investigating different viral production strategies or developing novel...silver stain approaches we show that there is no difference in purity or infectivity between the untreated...GFP-expressing AAV particles we did not observe any difference between untreated and sucrose treated cells. ...it will be exciting to test this approach with different capsids. Most importantly, because our AAV yields...spending less time and resources resupplying our current inventory and more time providing new materials...materials to the research community. References 1. Coroadinha, A. S., et al. "Effect of osmotic pressure on...
  16. Addgene Receives NIH BRAIN Initiative Grant to Create Open-Access Recombinant Antibody Resource

    Type
    Blog Post
    ...National Institutes of Health.     References and Resources References Bradbury A, Plückthun A (2015) Reproducibility...that secrete antibodies in culture and provide renewable reagents with reliable and reproducible production...made available through our usual service (see our current antibody plasmid collection) and we plan to introduce...working with the community to create a fully transparent resource where researchers can easily share, ... Trimmer JS, Görnemann J, Glanville J, Wolf P, Frenzel A, Wong J, Koh XY, Eng H-Y, Lane D, Lefranc M-P...
  17. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...sensors offer different levels of apparent dopamine affinity, with 113050 offering high apparent affinity,... various AAV serotypes can be used to achieve different patterns of expression, researchers often need...affinity, and 113049 offering medium apparent affinity. Plasmid Serotype Name 113050 AAV9, AAVrg pAAV-hSyn-GRAB_DA1h...Glutamate sensors iGluSnFR is a useful tool from Loren Looger’s lab at Janelia for neuroscientists to measure...
  18. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...work demonstrates that different repair template strategies activate different HDR sub-pathways like synthesis-dependent...live updates! My most popular tweet from the conference is shown above. The blog post I mentioned, John...post-CRISPR cleavage When I first looked at the conference agenda, I was surprised to see that it would ...Having had time to digest my notes, since the conference, I think I may have finally grasped just how ...Subscribe to CRISPR updates on our blog to keep current with the latest and greatest! Addgene resources...
  19. Sequencing Options for CRISPR Genotyping

    Type
    Blog Post
    ...This post was contributed by guest blogger Søren Hough, a Biochemistry PhD candidate at the University...double-stranded breaks (Tsai et al. 2015). Additionally, current algorithms do not take into account other elements...sequencing (Hendel et al. 2015), a significant difference as CRISPR experiments move closer to the clinic...and Joung 2016. Many thanks to our guest blogger Søren Hough. We additionally thank Monica Sentmanat, Victor...Ajetunmobi for their contributions to this work. Søren Hough is a Biochemistry PhD candidate in the laboratory...https://magazine.scienceforthepeople.org/.     References 1. Fu, Yanfang, et al. "High-frequency off-target..."Quantifying on-and off-target genome editing." Trends in biotechnology 33.2 (2015): 132-140. PubMed PMID...
  20. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ... Gal4 lines and study gene expression in many different tissue types! Although putting a gene of interest... overexpressed in several cell types by using different Gal4 drivers. It is much easier to mate flies ...one gene in one cell type and another gene in a different cell type (6–8). Although it’s often very easy...the meantime, be sure to browse the publication references and web links from my first post and start designing...jonchowphd but he still reads “#” as a “pound symbol”. References 1. A. H. Brand, N. Perrimon, Targeted gene expression...systems in Drosophila: A synthesis of time and space, Trends Genet. 20, 384–391 (2004). PubMed PMID: 15262411...
Showing: 421 - 440 of 1014 results