Skip to main content

We narrowed to 736 results for: RAN-1

Showing: 521 - 540 of 736 results
  1. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ...et al., 2019; McLaughlin, 2019).    Figure 1: Schematic of multiplex immunofluorescence approaches...). Springer New York. https://doi.org/10.1007/978-1-4939-8935-5_26 Jambor, H., Antonietti, A., Alicea,...palette for display (like green-magenta-blue or orange-blue rather than red-green). Even better, show ....2846 Radtke, A. J., Kandov, E., Lowekamp, B., Speranza, E., Chu, C. J., Gola, A., Thakur, N., Shih, R...
  2. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ...Kan, SpHIS5, or CaURA3 selection marker. Lee et al.(1) assessed many of these fluorescent tags in S. cerevisiae...life repair genomic damage, specifically double strand breaks. Researchers have long taken advantage of...product is introduced into the cell by direct transformation. A given insert will typically contain both...selectable gene product for isolation of successful transformants. Addgene distributes several ready-to-use, modular...
  3. IBEX Knowledge-Base: A Data Resource for Multiplex Tissue Imaging

    Type
    Blog Post
    ...that work for our experiments!)     Figure 1: The IBEX Imaging Community front page. That’s...data, more discussion, and more functionality. Transparency, both in what works and in what doesn’t, and...Ichise, H., Gola, A., Kabat, J., Lowekamp, B., Speranza, E., Croteau, J., Thakur, N., Jonigk, D., Davis...00644-9 Radtke, A. J., Kandov, E., Lowekamp, B., Speranza, E., Chu, C. J., Gola, A., Thakur, N., Shih, R...
  4. What's New in CRISPR - March 2020

    Type
    Blog Post
    ...plasmids CRISPRi in Caulobacter crescentus Figure 1: Serial dilutions of CRISPRi in Caulobacter cells ...The system consists of dCas9, the mammalian transcriptional repressor Mxi1, and an optogenetic tool that...CRISPRi plasmids A multiplexed gRNA piggyBac transposon system for human pluripotent stem cells Lindy...and gRNAs whose expression varies depending on transgene design and delivery. They generated hPSC lines...
  5. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...save that application for another day! References 1. Tanenbaum, Marvin E., et al. “A protein-tagging system...better. More transcription factor binding sites in a promoter lead to higher transcriptional activation....for single molecule imaging, finding that plasma membrane-targeted CAAX-SunTag was 18-fold brighter than...
  6. Chemogenetics vs. Optogenetics: Which Method Should I Choose?

    Type
    Blog Post
    ...depends on what you are looking to study. Figure 1: A schematic showing the differences in chemogenetics... have pushed the boundaries in neuroscience by granting targeted control over neuronal activity. While... Mouse studies, however, require a permanent intracranial implant to be surgically installed to allow ...receptors Invasiveness Mice require permanent intracranial implant Noninvasive Controlling Stimulation...
  7. New CRISPR Web Resources and #12DaysofCRISPR Recap

    Type
    Blog Post
    ...social media? No problem - see our recap below! Day 1: gRNA design tools: How to Design your gRNA for CRISPR...or A:T->G:C edits in DNA without causing double-strand breaks. Our new page shows you base editing plasmids...certainly taken notice! Our newest page in the Transcriptional Regulation category already has five blue flame...with eSpCas9, SpCas9-HF1, & HypaCas9 Day 10: Transcriptional regulation: Truncated gRNAs for Regulating ...
  8. 9 tips for a successful postdoctoral experience

    Type
    Blog Post
    ... successful postdoc fellowship. 1. Reverse engineer success On Day 1 of your postdoctoral experience,...postdoctoral fellows (PFs) face a number of challenges ranging from long periods of training to limited job opportunities...preparation) A history of successful funding (fellowship grants) A project with sufficient preliminary data to...your own lab and get an independent investigator grant (e.g. an R01 from the NIH, in the United States)...postdoctoral mentor. A good mentor typically writes the grants that fund your research, guides the research directions... available for mentees due to travel, teaching, grant writing, etc. Also, it is unlikely that a mentor...reference, informal recommendations, more positive grant application and manuscript reviews, etc. You'll ...
  9. Working 9-5: an Addgene Co-op

    Type
    Blog Post
    ... everyone was very approachable.     Fig. 1: Examples of DNA sequencing QC work    In addition...with a detailed training schedule that helped me transition easily. Training and responsibilities Through... the “9-5” was not as scary as it seemed. The transition into a traditional work environment was aided...
  10. Scientific Sharing in the Time of COVID-19: Databases and Resources

    Type
    Blog Post
    ... towards understanding this disease. Figure 1: Scientists are continuing to do essential research...community response initiatives. Accelerate the translational impact of research Universities have also been...creating research synergies and accelerating the translational impact of research activities. By streamlining...
  11. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ... antibody recognizes and binds to.   Figure 1: Labeled diagram of an antibody including Fc, Fab,...45. https://doi.org/10.1016/B978-012198382-6/50026-1 Wang R, Xiang S, Feng Y, Srinivas S, Zhang Y, Lin ...weight by SDS-PAGE, and are subsequently transferred to a membrane. A primary antibody recognizing the protein...is added, and will bind to that protein on the membrane. Then, addition of a secondary antibody allows...showing GFP expression in cells that have been transfected with a plasmid encoding GFP. Actin, a common ...bind to proteins on the cell surface, or the cell membrane can be permeabilized to allow antibodies to bind...
  12. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ...you do just this, probably in less than a minute (1). Green Listed is a new software tool used to design...found through https://wermelinglab.com/.   References 1. Panda, Sudeepta Kumar, et al. "Green listed—a CRISPR... modified cells are transferred into an animal and the behavior of the transferred cells is followed. ...generating a massive amount of descriptive transcriptomics data. Custom CRISPR screens designed to target...pathway with many receptors, signaling molecules, transcription factors, and ligands. The presenter then showed...
  13. Binning Singletons: Tackling Conference Networking When You Don’t Know Anyone

    Type
    Blog Post
    ...the most out of their meetings. Amanda Gunn ran randomized coffee trials for us at ASCB|EMBO 2019, matching... Figure 1: The Binning Singletons logo. Image: James et al., 2020. Help me stranger - Finding mentors...within a bin as Horizontal Transfer. This comes from horizontal gene transfer, which occurs when bacteria...in Atlanta, GA, in 2018. A lot of my experiences rang true with theirs.  It was at this dinner and the...
  14. Understanding GPCR Signaling Using TRUPATH

    Type
    Blog Post
    ...updated version of BRET called BRET2. Figure 1: TRUPATH measures heterotrimeric G protein dissociation...-visual G protein signal transducers (collectively known as the transducerome) that can be activated downstream...Resonance Energy Transfer (BRET). BRET is similar to Förster Resonance Energy Transfer (FRET), in which...non-visual G protein transducers. To use the TRUPATH system, cells are transfected with plasmids expressing...including smell, taste, sight, inflammation, and neurotransmission. But with approximately 950 different human...involved in sight (Olsen RHJ et al., 2020). A transducer complex consists of a trimer of three subunits...such a tool is being able to identify specific transducer complexes that are activated in response to a...
  15. Meet the New Addgene Board Members!

    Type
    Blog Post
    ...enables the high-resolution tracking of more than 1 million cancer cells under drug treatment.” Stegmeier...members to the Board of Directors: Khandan Baradaran, Frank Stegmeier, and Luk Vandenberghe. We’re excited...members and get to know them! Khandan Baradaran, PhD Khandan Baradaran’s expertise in viral safety, gene therapy... with health authority regulations,” Baradaran says.  Baradaran’s path to science began in high school... getting these reagents is profound.” Frank Stegmeier, PhD Frank Stegmeier is the Chief Scientific Officer...in viral genetics. In regards to open science, Baradaran thinks the best way to solve problems is to work...think will get the research funded,” she says. Baradaran met Addgene Executive Director Joanne Kamens several...
  16. Sensing Neuronal Dopamine

    Type
    Blog Post
    ...brain where DA quantitation is desired (Figure 1). The probe perfuses liquid, which causes the passive diffusion...dopamine (DA), a well-known reward chemical and neurotransmitter. But aside from DA’s famous role as the “happy...standard method of measuring DA and other neurotransmitters in the brain has been in vivo microdialysis...performed with a probe surrounded by a semipermeable membrane, which is inserted into the region of the brain... diffusion of DA across the semipermeable membrane from the extracellular fluid into the perfused liquid... to a threatening looming stimulus in vivo in transgenic zebrafish Report DA release in live mice over...developments in the detection and measurement of neurotransmitters in various species and while exhibiting complex...
  17. Antibodies 101: Epitope Availability

    Type
    Blog Post
    ... to just that particular assay.      Fig. 1: A native protein (left) is denatured, allowing the...bound to anything? Is it a transmembrane protein, or is it know to translocate or fold in certain conditions...as part of performing a specific function. A transmembrane protein that is being used as a marker for flow...cell, instead of when it is attached to a cell membrane.  Picking the Right Antibody  It can get even ...looking for a protein of interest while it’s in a transition state or specific configuration. So how do you...
  18. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...
  19. Choosing Your Perfect Empty Backbone

    Type
    Blog Post
    ...vectors (e.g. pBV-Luc) and gene silencing (e.g. pLKO.1 - TRC cloning vector). Check out our complete guide...). If you can get away with generating transiently transfected cells, you will not need a mammalian selection...mammalian selection cassette to screen for positive transfected cells. The addition of an in-frame fluorescent...create a new strain with a disrupted gene by transforming wild-type yeast with an integrating vector expressing...majority of fly vectors are based on p-element, random or targeted, integration into the fly genome and...applications used to study gene function. From making transgenic animals, gene targeting and genome modifications...
  20. Why Add Sucrose? Improved Yields for Adeno-associated Virus Preparation

    Type
    Blog Post
    ...materials to the research community. References 1. Coroadinha, A. S., et al. "Effect of osmotic pressure... AAV2 interacts with the packaging cell's cell membrane When packaging adeno-associated viral vectors ...to be due to the viral particle’s affinity for heparan sulfate proteoglycans on the surface of the packaging...supernatant, the viral particles associate with the cell membrane and are taken into the cell via endocytosis. In...looking to improve their AAV yields. Given the wide range of downstream applications scientists rely on our...preparation. Through sugar detection assays, in vitro transduction, and silver stain approaches we show that there...test the endocytosis of a fluorescent dye and transduction of GFP-expressing AAV particles we did not observe...
Showing: 521 - 540 of 736 results