Skip to main content

We narrowed to 15 results for: RAN-1

Showing: 1 - 15 of 15 results
  1. Adenovirus Guide

    Type
    Guide
    ...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...enzyme PmeI . This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183...plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For especially long transgenes, the use of...gene therapy landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or...production system. Figure is based on the use of pAdEasy-1. AdMax™ AdMax™ is another well used rAdV vector production...as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020-60238-5...
  2. Chemogenetics Guide

    Type
    Guide
    ...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org/10.1073/pnas.95.1.352 PMID... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...
  3. Lentiviral Vector Guide

    Type
    Guide
    ... typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...— contains transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid...pre-infusion CAR T-cell products. Journal of Translational Medicine , 20 (1). https://doi.org/10.1186/s12967-022...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. All retroviruses use...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Feature...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...
  4. Modular Cloning Guide

    Type
    Guide
    ...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...directionally assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter...coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...
  5. CRISPR Guide

    Type
    Guide
    ...Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann...pooled format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9..., 1163–1171. PMID: 23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D..., 17 (5), 471–479. PMID: 32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I....CRISPR-Cas9. Cell , 167 (7), 1829-1838.e9. PMID: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott...Nature Protocols , 8 (11), 2281–2308. PMID: 24157548 Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg...Communications , 14 (1), 6175. PMID: 37794046 Small precision edits Anzalone, A. V., Randolph, P. B., Davis,...
  6. Optogenetics Guide

    Type
    Guide
    ...or read on to learn more about these tools. Figure 1: A typical optogenetics experiment. A channelrhodopsin...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of A. sativa phototropin 1 ~450–495 LOVTRAP Zdk binds to the LOV domain in the...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...generate two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain...
  7. Promoters

    Type
    Guide
    ...sense or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...noncoding strand, as this is the strand that is transcribed by the RNA polymerase. Figure 1: Simplified promoter...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...to the mRNA transcript produced. The antisense strand is referred to as the template strand or noncoding...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding...template for the translation of a protein. RNA polymerase III — transcribes genes encoding transfer RNAs (tRNA... eukaryotic promoters, including transcription and the transcription complex. Educational...
  8. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...expression of the full-length transgene, but also at a very low efficiency (less than 1% of wild-type). Another...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. AAVs are part of the Dependoparvovirus...extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...
  10. Plan Your Experiment

    Type
    Guide
    ...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...
  11. Molecular Biology Reference

    Type
    Guide
    ... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. The Genetic Code The..., double-stranded helix. To create the double helix, the nucleotides on the opposing strands of DNA form...proteins can be translated, the DNA is converted to RNA in a process called transcription. RNA uses the ...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. All gamma-retroviral... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line...
  13. Antibody Guide

    Type
    Guide
    ...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...
  14. Guide to Using Pooled Libraries

    Type
    Guide
    ...also negatively affect data reproducibility. Figure 1: Simplified flow chart for amplifying and using a ...libraries contain plasmids with unique, semi-random or random sequences that can be used for applications...proteins (such as cell surface receptors or transcription factors), or observing the effects of mutagenesis...large numbers of plasmids, each with a short, randomized, unique nucleotide sequence, or barcode, used...libraries direct an inactive Cas enzyme fused to a transcriptional activator to target genes or regulatory regions...regions, where it stimulates transcription by recruiting activators or modifying local chromatin. Inhibition...an inactive Cas enzyme (alone or fused to a transcriptional repressor) to target genes, where it represses...
  15. Molecular Cloning Techniques

    Type
    Guide
    ...more in our Restriction Cloning blog post . Figure 1: Restriction enzyme cloning of your gene of interest...by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ... They also cut specific target sequences, which range from four to 13 base pairs, and produce predictable... with four nicks that bacteria repair after transformation. LIC does not require site-specific recombination...exonuclease until a base is exposed on the single-strand overhang that is complementary to the free nucleotide... is rendered unnecessary. The product may be transformed directly into E. coli , where the normal replication...
Showing: 1 - 15 of 15 results