We narrowed to 13 results for: RAN-1
-
TypeGuide...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...enzyme PmeI . This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183...plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For especially long transgenes, the use of...gene therapy landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or...production system. Figure is based on the use of pAdEasy-1. Created with BioRender.com. AdMax™ AdMax™ is another...as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020-60238-5...
-
Lentiviral Vector Guide
TypeGuide... typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...— contains transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid...pre-infusion CAR T-cell products. Journal of Translational Medicine , 20 (1). https://doi.org/10.1186/s12967-022...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation... -
Modular Cloning Guide
TypeGuide...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...directionally assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter...coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ... -
CRISPR Guide
TypeGuide...Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann...pooled format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9..., 1163–1171. PMID: 23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D..., 17 (5), 471–479. PMID: 32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I....CRISPR-Cas9. Cell , 167 (7), 1829-1838.e9. PMID: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott...Nature Protocols , 8 (11), 2281–2308. PMID: 24157548 Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg...Communications , 14 (1), 6175. PMID: 37794046 Small precision edits Anzalone, A. V., Randolph, P. B., Davis,... -
Optogenetics Guide
TypeGuide... phototropin 1 LOVETRAP reversibly sequester and release proteins from cellular membranes using light....algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...wavelengths, ranging from blue to yellow to red. Red light exhibits better tissue penetrance, which may ...including protein activation, membrane localization, and transcriptional activation. In the widely used... -
Sequencing Primers
TypeGuide... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter... CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab... -
Adeno-associated virus (AAV) Guide
TypeGuide...expression of the full-length transgene, but also at a very low efficiency (less than 1% of wild-type). Another...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between... -
Plan Your Experiment
TypeGuide...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate... -
Molecular Biology Reference
TypeGuide...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Delta(lac- proAB) [F ...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. DNA is comprised of ...Region Drives transcription of the insert. The promoter is designed to recruit transcriptional machinery ... a base on one strand pairs with a particular base on the other, complementary, strand. Specifically, ... -
Chemogenetics Guide
TypeGuide...out our Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic ligand. The chemogenetic...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...in Japan, making it an attractive option for translational studies, however, it has off-target effects....hM4Di, and is especially attractive for use in translational studies because it is FDA and EMA approved. ... -
Gamma-Retroviral Vector Guide
TypeGuide...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line... -
Promoters
TypeGuide...Strong mammalian promoter from human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter... sense or coding strand of the transcribed gene. The coding strand is the DNA strand that encodes codons...to the mRNA transcript produced. The antisense strand is referred to as the template strand or non-coding...non-coding strand as this is the strand that is transcribed by the RNA polymerase. DNA sequences called response...initiation of transcription whereas transcription factors promote the initiation of transcription. The most...template for the translation of a protein. RNA polymerase III transcribes genes encoding transfer RNAs (tRNA...reference material covering promoters, transcription and the transcription complex. Plasmid... -
Antibody Guide
TypeGuide...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...