Skip to main content

We narrowed to 1,041 results for: CAT

Showing: 561 - 580 of 1041 results
  1. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

    Type
    Blog Post
    ...aggregates. This property can be tolerated in some applications (e.g. labeling of cells or tracking promotor...promotor activity), but it is problematic in applications in which the fluorescent protein is used as an inert...During the experiment, the solution is diluted, complicating the interpretation. Because of this, these methods...aware that the fluorescent proteins reported in publications are only characterized under a limited number...build a valuable resource with tools and data that indicate the performance of (a set of) fluorescent proteins...
  2. The Breast Cancer Microenvironment: A Tumor’s Backstage Team

    Type
    Blog Post
    ... these stromal cell modifications, stromal cells are also constantly communicating with a tumor, proving... was contributed by Bárbara Pinho, a science communicator at the Portuguese science museum "Fábrica Centro...Proficient in transportation, exosomes are tools of communication and provide malignancy to the microenvironment... Pinho! Bárbara Pinho is currently a science communicator at the Portuguese science museum "Fábrica Centro...
  3. Viral Vectors 101: An Introduction to AAV

    Type
    Blog Post
    ...experiments. Recombinant AAVs (rAAVs) The primary application of AAV is delivery of genetic cargo to a host...numerical designations, separated by a slash, that indicate the ITR and serotype, respectively. For example...transduced gene is episomal and does not divide and replicate in the same way the host DNA does. Because of ... since you don’t have to wait for the host to replicate the DNA before expression. Now that you’ve got... S., et al. “Various AAV Serotypes and Their Applications in Gene Therapy: An Overview.” Cells, 12(5),...
  4. Supporting Rare Disease Research with the 2020 BeHEARD Awards

    Type
    Blog Post
    ...seizures, and other symptoms as discussed in this educational video. “SLC6A8 belongs to a large family of solute.... “This proof of concept study will help in identification of new targets that could greatly enhance our...professor and assistant dean of biomedical science education at McGill University.  These protein-receptor ...58 individuals with GNB1 disorder since the identification of this disease in 2016. The lab aims to “expand...pathways using biosensors as well. “The Addgene catalog would allow us to enhance our biosensor repository...
  5. RNA Extraction Without A Kit

    Type
    Blog Post
    ...of DNA that can potentially complicate results of a downstream application such as quantitative PCR to...easier. Recently, we published a blog on DNA purification without a kit that outlined several reasons ...take care whenever doing any type of DNA or RNA purification to avoid contamination, take extra care when..., that isn’t the case for RNA extraction and purification. There is one simple method that works, and ...
  6. Split-BioID: An Improved Method for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...methods for identifying PPIs, such as affinity purification mass spectrometry (AP-MS), lack the ability ...the validation of a binary PPI as well as the identification of additional interacting factors. Problems...detect weak and/or transient PPIs. Many PPI identification techniques rely on protein interactors to stay... AP-MS. This requirement often prevents the identification of weak and/or transient interacting proteins...spatiotemporally defined protein complexes. Nature communications. PubMed PMID: 28585547. PubMed Central PMCID...
  7. Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

    Type
    Blog Post
    ...including RNPs for indel formation via NHEJ, precise modification with Homology Directed Repair (HDR), CRISPR ...potential to be used for other types of CRISPR applications. Let’s take a look at the key components of ... which means they are non-infectious and non-replicative. Nanoblades are produced by transfecting the ...incubating Nanoblade particles with polybrene, a cationic polymer. Polybrene has long been used to increase...with Cas9-sgRNA ribonucleoproteins." Nature communications 10.1 (2019): 45. PubMed PMID: 30604748. PubMed...
  8. Mouse Modeling, Part 2: Breeding and Crossing Mice

    Type
    Blog Post
    ...techniques that can be used to introduce genetic modifications into mouse embryos. But once you generate a ...techniques are each useful for introducing one modification into the mouse genome, they are not commonly...parental mice In order to ensure that your genetic modification will be passed along to all of the offspring...environment and will harbor similar epigenetic modifications. Special breeding cases Whether your mouse colony...the mutations that you are trying to cross are located on homologous chromosomes in the parental generation...
  9. Mouse Modeling, Part 1: Genetically Engineered Mice

    Type
    Blog Post
    ...stimuli. Cre recombinase catalyzes the recombination of DNA sequences located between two loxP sites. ...in research can fall under one of two broad classifications: inbred or outbred. Inbred strains share a ...Knockout mice Knockout mice have undergone genetic modification that alters or eliminates the expression of ...can be used to invert a segment of DNA or to translocate a piece of DNA from one region of the genome ...
  10. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ...2021.   The potential tools fall into two categories: probes and editors. A probe array may consist...and should be varied as it can have important implications for the fusion protein effectivity), and a fluorescent...to visualize DNA, an editor targets DNA (via catalytically inactive dCas9) to modify chromatin. A fluorescent...both spatiotemporal protein degradation and quantification of this depletion using imaging-based measurements...BioTag, which can be used in protein affinity purification studies.    Duong et al., Genetics 2021. https...
  11. 5 Tips for Troubleshooting Viral Transductions

    Type
    Blog Post
    ...experiment and they don't do anything. Viruses are complicated and they perform complex biological tasks, both...vector may undergo genomic rearrangements during replication. To avoid genomic rearrangements, try amplifying...membranes (Davis et al., 2002). Polybrene is one such cationic reagent that is commonly used and has been shown... during transfection, and does not necessarily indicate the production of virus. Alternatively, if the...hepatitis B virus DNA and hepatitis C virus RNA quantification as measured with branched-DNA technology." ...
  12. Fluorescent Proteins 101: Visualizing Subcellular Structures & Organelles

    Type
    Blog Post
    ...functionality can be gained by understanding the location and transport of the protein within a living cell...to observe membrane trafficking events in vivo. Locate your protein and see who it is hanging out with...potential overlap, it is possible to determine the location of proteins within complex structures. In order...way it is important to choose the appropriate quantification methods and tools. It is usually not enough...intracellular pathogens In addition to tracking the location of proteins it is also possible to follow the ...
  13. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    ... (green or blue) within a population of timer indicates the age of the pool: the higher the ratio, the...-FT-N1 pTRE-Slow-FT pBAD/HisB-Slow-FT -  Applications of fluorescent protein timers FP timers have...biological event (trafficking to a subcellular location, start of gene expression, development of a cell... insulin-secreting beta-like cells." Nature communications 7 (2016). PubMed PMID: 27063289. PubMed Central...Learn More About Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your...
  14. Google Forums Round Up: First Impressions of NgAgo

    Type
    Blog Post
    ...been excitedly testing NgAgo's genome editing applications. So, how does NgAgo stack up thus far? A few...survey. When asked if they could detect indels (an indication of gene disruption ability) with NgAgo, one respondent...could not achieve indels with the NgAgo system indicates that it is very tricky to use and fussy to optimize... S. Lander, and Feng Zhang. "Development and applications of CRISPR-Cas9 for genome engineering." Cell...Addgene.org Request NgAgo Find CRISPR Resources Catch Up on Your CRISPR Background ...
  15. Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More

    Type
    Blog Post
    ...? Patron: Sainsbury has a mandate to share and educate and enable plant science in general. We are funded...easier because individual labs will not need to ‘domesticate’ all the basic and necessary elements in order... you are in the lab. There is no PCR, no gel purification; the whole cloning process is so simplistic ...tweet about plant synthetic biology, science communication, women in science, and many other topics. What...well-rounded human beings. It’s also a great communication tool for work. Most Sainsbury scientists are...
  16. Drew Endy Introduces the Biobrick Public Agreement Plasmid Collection

    Type
    Blog Post
    ...Initiative. Endy's team made news in March with a publication in Science describing the development of “transcriptors...work, and it begins with the central dogma - replication of DNA, transcription of DNA to make RNA, translation..., humans have two types of languages: one to communicate amongst each other, like this conversation we... in English, and then there are languages to communicate with other things. These are programming languages...successful in the long term, if it's going to communicate between humans (i.e., our dreams and intentions...
  17. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...with the newest CRISPR technologies and their applications can be exhausting. A quick search for "CRISPR... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...
  18. Transferable Skills Guide: Identifying Your Transferable Skills

    Type
    Blog Post
    ...my job. The same can be said about teamwork, communication, writing, management, and creativity; I have...have the desired degree, you have mastered the applications they use, you’ve gained experience working with...to solve a problem. When they ask about your communication style, your potential teammates want to be assured...ve had to flex your conflict management and communication skills quite a bit. Grab a piece of paper and...Negotiation Career Planning Resources Cross team communication  External collaborators For further advice ...
  19. MXS Chaining

    Type
    Blog Post
    ...develop diverse fluorescent reporters is a useful application of high-throughput cloning. MXS Chaining is one...plasmids for fluorescence imaging or flow cytometry applications in mammalian cells. The modules used in this...transgene expression, or a variety of other clever applications. In one example, modular constructs generated...methods are suited for particular downstream applications. The tradeoffs between various cloning methods...technique to engineer various constructs with applications in flow cytometry approaches in mammalian cell...
  20. Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research

    Type
    Blog Post
    ...positioned like Cas12a PAM sites. For Cas9, the PAM is located just downstream (3′ end) of the target sequence...-strand breaks like those created by Cas12a. Applications of TnpB One of the major challenges in genome...5: Colony Screening Use Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 (specific to your target...viral vectors and for multiplexed gene editing applications. As research into TnpB continues to evolve, ...elaborate protocols are available in our earlier publications (Karmakar et al., 2024; Karmakar et al., 2025...
Showing: 561 - 580 of 1041 results