Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 18 results for: CAT

Showing: 1 - 18 of 18 results

  1. Educational Resources

    Type
    Guide
    ...Addgene's educational resources, including eBooks, science guides, videos, and protocols... Educational Resources...eBooks to videos and blog posts to protocols, our educational resources cover a wide range of topics in molecular...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...

  2. Sequencing Primers

    Type
    Guide
    ...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato... Reverse WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...

  3. CRISPR Guide

    Type
    Guide
    ... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the...

  4. Antibody Guide

    Type
    Guide
    ...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science...

  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...potential formation of replication-competent viruses. While AAV themselves are replication incompetent, there...production of replication-competent viruses that would be able to infect cells and replicate autonomously... actively causing symptoms or replicating. Lytic cycle Viral replication process where the virus uses ...into cells. Replication-competent rAAV Mutated rAAV vector that has the ability to replicate and reproduce.... The Rep region encodes four non-structural replication proteins (Rep78, Rep68, Rep52, and Rep40), which...which are involved in genome replication and viral packaging. The Cap region encodes three structural ...virus. The ITR sequences serve as origins of replication and also act as signals for packaging. Figure...

  6. Molecular Biology Reference

    Type
    Guide
    ...Origin of Replication ( ori ) DNA sequence which directs the initiation of plasmid replication in bacteria... not located elsewhere in the plasmid backbone. In expression plasmids, the MCS is often located downstream...advantage of the process of DNA replication in vitro. During replication, the DNA helix is unwound by a... Educational Resources Molecular Biology Reference Molecular...Chemistry techniques enable the isolation and purification of cellular components, such as DNA, but in ...that typically carry genetic information and can replicate independently from chromosomal DNA. Although they...conjugation. Like chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives...

  7. Adenovirus Guide

    Type
    Guide
    ... DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication starts...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate autonomously..., which has limited their use in therapeutic applications. However, this has also made them the most widely...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV...whereas the E1 region is essential for viral replication and therefore needs to be supplied through other... other early gene regions, E2 and E4. These modifications aimed to lower immunogenicity issues observed...also resulted in a reduction of viral vector amplification and overall lower viral titers. Because of this...

  8. Lentiviral Vector Guide

    Type
    Guide
    ...recently involved in translocation events, and other “fragile” genomic locations, and that this preference...therapeutic applications, like chimeric antigen receptor T cell (CAR-T) therapy, the location of integration...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery...of safety improvements and the potential for replication-competent lentivirus production — that is, creation...particles that could infect cells and further replicate on their own. While the viral components are still...Interchangeable; usually encodes for VSV-G Safety Safe; replication incompetent by using three separate plasmids ...

  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ... gamma-retroviral vectors integrate at random locations throughout the genome. Gamma-retroviral vectors...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...vectors are a popular choice in gene therapy applications. There are many approved gamma-retroviral gene...cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors. Gamma-retroviral...

  10. Optogenetics Guide

    Type
    Guide
    ...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...reporters of molecular signals; e.g., calcium indicators In this overview, we will focus on the common... electrochemical responses, such as nonspecific cation influx vs. proton efflux. Researchers have used...is excited by blue light and permits nonspecific cation influx into the cell when stimulated. Channelrhodopsin...optogenetic tool, is also a blue light activated cation channel. ChR2 is preferred over ChR1 because ChR2...been expanded by scientists through both the identification of novel ChRs from other algal species and ...

  11. Plan Your Experiment

    Type
    Guide
    ...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...start sites that could allow for expression of a truncated protein. Targeting an exon coding for an essential... Select a cut site as close as possible to the location of the desired edit, ideally less than 10 bp away...complex. You then delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach...

  12. Modular Cloning Guide

    Type
    Guide
    ...protein purification tags and fluorescence proteins for use in E. coli for a variety of applications. EcoFlex...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning... between. MoClo can be used for a variety of applications—like building synthetic genetic circuits, engineering... vectors for use in E. coli for a variety of applications. CIDAR MoClo Parts Kit Bacterial Expression ...multi-part assemblies in either integrative or self-replicating plasmid vectors for working in cyanobacteria....Cultivarium Tools 189 plasmids, including origins of replication and selection markers for a variety of bacterial... genome editing and transcription modulation applications Golden Gate TALEN and TAL Effector Kit 2.0 Genome...

  13. Guide to Using Pooled Libraries

    Type
    Guide
    ... Pooled Library Amplification Protocol for Addgene's generalized library amplification protocol. Read ...: Pooled Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...

  14. Promoters

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Promoters...BioRender.com. DNA sequences called response elements are located within promoter regions, and they provide a stable...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions... (TSS) (Figure 2). The Pribnow box (TATAAT) is located at the -10 position and is essential for transcription...BioRender.com. Core Promoter The core promoter region is located closest to the start codon and contains the RNA...

  15. Molecular Cloning Techniques

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Molecular...interest and then insert them into plasmids for replication and protein expression. There are many methods...restriction sites to any piece of DNA during PCR amplification, allowing for it to then be digested and ligated...cut your insert or backbone at only the desired location for your cloning project. Restriction enzyme cloning...transformed directly into E. coli , where the normal replication process will repair the nicks. It is important...

  16. Chemogenetics Guide

    Type
    Guide
    ...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534... KM, Brown KM, Forbes SL, Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer...

  17. Addgene's eBook Collection

    Type
    Guide
    ...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ...

  18. Science Guides

    Type
    Guide
    ...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...certain gene sets. Read More Viral Vectors Find educational guides to learn more about the different types...
Showing: 1 - 18 of 18 results