We narrowed to 17 results for: CAT
-
TypeGuide...Addgene's educational resources, including eBooks, science guides, videos, and protocols... Educational Resources...eBooks to videos and blog posts to protocols, our educational resources cover a wide range of topics in molecular...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...
-
Sequencing Primers
TypeGuide... Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT 5' end ...primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin...sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...used a number of primers for sanger sequence verification of deposited plasmids. Below is a list of commonly... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1... -
CRISPR Guide
TypeGuide... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the... -
Antibody Guide
TypeGuide...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science... -
Adeno-associated virus (AAV) Guide
TypeGuide...potential formation of replication-competent viruses. While AAV themselves are replication incompetent, there...production of replication-competent viruses that would be able to infect cells and replicate autonomously... actively causing symptoms or replicating. Lytic cycle Viral replication process where the virus uses ...into cells. Replication-competent rAAV Mutated rAAV vector that has the ability to replicate and reproduce.... The Rep region encodes four non-structural replication proteins (Rep78, Rep68, Rep52, and Rep40), which...which are involved in genome replication and viral packaging. The Cap region encodes three structural ...virus. The ITR sequences serve as origins of replication and also act as signals for packaging. Figure... -
Molecular Biology Reference
TypeGuide... Origin of Replication ( ori ) DNA sequence which directs initiation of plasmid replication (by bacteria... Educational Resources Molecular Biology Reference Molecular...plasmid selection DNA sequencing for plasmid verification Resources Genetic Code Webpage and Blog References...Techniques in chemistry enable isolation and purification of cellular components, such as DNA, but practically...double-stranded DNA that typically carry genes and can replicate independently from chromosomal DNA. Although they...the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives...manipulating genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - ... -
Adenovirus Guide
TypeGuide... DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication starts...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate autonomously..., which has limited their use in therapeutic applications. However, this has also made them the most widely...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV...whereas the E1 region is essential for viral replication and therefore needs to be supplied through other... other early gene regions, E2 and E4. These modifications aimed to lower immunogenicity issues observed...also resulted in a reduction of viral vector amplification and overall lower viral titers. Because of this... -
Lentiviral Vector Guide
TypeGuide...recently involved in translocation events, and other “fragile” genomic locations, and that this preference...therapeutic applications, like chimeric antigen receptor T cell (CAR-T) therapy, the location of integration...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery...of safety improvements and the potential for replication-competent lentivirus production — that is, creation...particles that could infect cells and further replicate on their own. While the viral components are still...Interchangeable; usually encodes for VSV-G Safety Safe; replication incompetent by using three separate plasmids ... -
Gamma-Retroviral Vector Guide
TypeGuide...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ... gamma-retroviral vectors integrate at random locations throughout the genome. Gamma-retroviral vectors...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...vectors are a popular choice in gene therapy applications. There are many approved gamma-retroviral gene...cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors. Gamma-retroviral... -
Optogenetics Guide
TypeGuide...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...reporters of molecular signals; e.g., calcium indicators In this overview, we will focus on the common... electrochemical responses, such as nonspecific cation influx vs. proton efflux. Researchers have used...is excited by blue light and permits nonspecific cation influx into the cell when stimulated. Channelrhodopsin...optogenetic tool, is also a blue light activated cation channel. ChR2 is preferred over ChR1 because ChR2...been expanded by scientists through both the identification of novel ChRs from other algal species and ... -
Plan Your Experiment
TypeGuide...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...start sites that could allow for expression of a truncated protein. Targeting an exon coding for an essential... Select a cut site as close as possible to the location of the desired edit, ideally less than 10 bp away...complex. You then delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach... -
Guide to Using Pooled Libraries
TypeGuide... Pooled Library Amplification Protocol for Addgene's generalized library amplification protocol. Read ...: Pooled Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided... -
Promoters
TypeGuide...polymerase. DNA sequences called response elements are located within promoter regions, and they provide a stable...cells. Core Promoter The core promoter region is located most proximal to the start codon and contains the...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions...eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and is essential for transcription... -
Cloning
TypeGuide...interest and then insert them into plasmids for replication and protein expression. So how do scientists ...restriction sites to any piece of DNA during PCR amplification, allowing for it to then be digested and ligated...cut your insert or backbone at only the desired location for your cloning project. Restriction enzyme cloning...where the nicks will be repaired by the normal replication process. It is important to note that LIC has... -
Chemogenetics Guide
TypeGuide...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534... KM, Brown KM, Forbes SL, Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer... -
Addgene's eBook Collection
TypeGuide...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ... -
Science Guides
TypeGuide...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...certain gene sets. Read More Viral Vectors Find educational guides to learn more about the different types...