Skip to main content

We narrowed to 61 results for: MOM

Showing: 41 - 60 of 61 results
  1. PhD Applications After COVID

    Type
    Blog Post
    ...in-person plans. Virtual options are very handy in moments like that! For instance, during my application...
  2. Transferable Skills: Negotiation

    Type
    Blog Post
    ...awareness of when you are negotiating. Then take a moment before, during, or after a negotiation to think...
  3. Plasmids 101: Protein tags

    Type
    Blog Post
    ...peptide (CBP), a TEV cleavage site (more on that in a moment), and 2 ProtA IgG-binding domains. TAP has since...
  4. How to Be an Excellent Trainee

    Type
    Blog Post
    ...the corner freezer sounds easy to remember in the moment….but you’ll probably forget and end up asking your...
  5. Sequencing Primers

    Type
    Guide
    ...ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus (MoMuLV) LTR Forward mPGK-F CATTCTGCACGCTTCAAAAG Mouse ...
Showing: 41 - 60 of 61 results