We narrowed to 61 results for: MOM

... training for new managers and I had a “Eureka” moment while reviewing the results of my Myers-Briggs ...

...the conference Review your favorite conference moments on social media and if there was something you ...

...in-person plans. Virtual options are very handy in moments like that! For instance, during my application...

...awareness of when you are negotiating. Then take a moment before, during, or after a negotiation to think...

...review why NgAgo is in the spotlight and take a moment to remember that NgAgo has only been available ...

...search. We’ll take a closer look at filters in a moment. First, I want to highlight the convenient ways...

..., Huh W-K (2018) Global analysis of protein homomerization in Saccharomyces cerevisiae. Genome Res 29:...

...often taken for granted. In this post, we take a moment to review what exactly you are measuring and how...

...peptide (CBP), a TEV cleavage site (more on that in a moment), and 2 ProtA IgG-binding domains. TAP has since...

...pv. campestris, X. campestris pv. malvacearum, Zymomonas mobilis pBBR1 based pBBR1  Gram-negative...

...the corner freezer sounds easy to remember in the moment….but you’ll probably forget and end up asking your...

...includes everything from tracking plasmids from the moment a deposit kit is sent to a depositor, to streamlining...

...Temperature Imaging with a Genetically Encoded Nanothermometer. Nano Lett. 2022 Jul 27;22(14):5698-5707. doi...

...Listening: In one of my favorite books, Michael Ende’s Momo, the title character endears herself to the nearby...

...products that resulted from their research, “aha” moments, and future research directions. Don’t worry if...

...element. You did a lot of work! But let’s take a moment to recognize your little prokaryotic minions that...

...good place to start for biased validation At the moment, many software tools predict off-target effects...

... different gRNAs are used for each gene. At the moment, 13 full genome SpCas9 knockout libraries designed...

... trouble is, with so much choice, in those few moments after the piñata burst, value was subjectively ...

...ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus (MoMuLV) LTR Forward mPGK-F CATTCTGCACGCTTCAAAAG Mouse ...