We narrowed to 93 results for: c myc
-
TypeBlog Post...Jung JP, Pack C-G, Huh W-K (2018) Global analysis of protein homomerization in Saccharomyces cerevisiae....information, you can fuse each FP fragment to the N- and C-terminal end of each PIP and empirically test which...R, Björklund M, Ahr D, Ahmed AW, Spinelli L, Brun C, Basler K, Merabet S (2018) Generation of a versatile.... eLife 7. https://doi.org/10.7554/elife.38853 Hu C-D, Chinenov Y, Kerppola TK (2002) Visualization of...https://doi.org/10.1101/gr.231860.117 Kodama Y, Hu C-D (2012) Bimolecular fluorescence complementation ...
-
Tips for Screening with Yeast Two Hybrid Systems
TypeBlog Post...El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino, C., Fleischer, C., Ellerbrok, H., Kamuzinzi, R., Ledent...organisms, including bacteria, alternative fungi (C. albicans, pC2HB) (7) and mammalian cells. If the ... prey libraries can be screened using both N- and C-terminal fusions of these proteins. This way both ...Two hybrid systems were developed in Saccharomyces cerevisiae in 1989 and are still used extensively ... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post... of cytidine and adenine base editors that enable C-to-T and A-to-G base substitutions respectively. Substitutions...:723–728 . https://doi.org/10.1021/sb500351f Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG (2018... https://doi.org/10.1016/j.cell.2013.02.022 Ronda C, Pedersen LE, Sommer MOA, Nielsen AT (2016) CRMAGE...Vridhambal GS, Rivera AJ, Montgomery SA, Fortier L-C, Barrangou R, Theriot CM, Ousterout DG (2020) In Vivo...shorter plasmid curing time. pCRISPomyces for editing in Streptomyces Streptomyces bacteria produce a wide...created two “pCRISPomyces” systems for use in Streptomyces (Cobb et al., 2015). pCRISPomyces-1 includes ...array, while pCRISPomyces-2 contains Cas9 and a gRNA cassette. The simpler system of pCRISPomyces-2 displays... -
Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation
TypeBlog Post...02708-5 Hrit J, Goodrich L, Li C, et al. (2018) OGT binds a conserved C-terminal domain of TET1 to regulate...89–92. https://doi.org/10.1038/301089a0. Galonska C, Charlton J, Mattei AL et al (2018). Genome-wide tracking...https://doi.org/10.7554/eLife.34870. Kaas GA, Zhong C, Eason DE, Ross DL, Vachhani RV, Ming G-L, King JR...lentiviral backbones expressing blasticidin or puromycin resistance genes. It’s that simple! Good luck... -
CRISPR 101: Non-Homologous End Joining
TypeBlog Post...Oh S, Tomkinson AE, Hendrickson EA, Giovannangeli C, Jasin M, Brunet E (2014) Chromosomal Translocations.../10.1016/j.molcel.2014.08.002 Ran FA, Hsu PD, Lin C-Y, Gootenberg JS, Konermann S, Trevino AE, Scott DA... Yan M-Y, Li S-S, Ding X-Y, Guo X-P, Jin Q, Sun Y-C (2020) A CRISPR-Assisted Nonhomologous End-Joining...End-Joining Strategy for Efficient Genome Editing in Mycobacterium tuberculosis. mBio 11: . https://doi.org/10.1128... -
Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research
TypeBlog Post...Maher, M. F., Nasti, R. A., Vollbrecht, M., Starker, C. G., Clark, M. D., & Voytas, D. F. (2019). Plant gene...0337-2 Molla, K. A., Sretenovic, S., Bansal, K. C., & Qi, Y. (2021). Precise plant genome editing using...Gao, Q., Liu, S., Zhang, X., Hu, W., Wang, Y., Han, C., Li, D., & Wang, X. (2025). Transgene- and tissue...plasmids contain a hygromycin resistance gene as the plant-selectable marker and a kanamycin resistance gene... -
Four Base Editing Reporters to Monitor and Enrich Editing in Real-time
TypeBlog Post...expressed to identify successfully transfected cells. C-to-T editing by the APOBEC-Cas9 editosome would restore...codon that is converted to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes the histidine... ATG codon from an ACG codon using a base-editor (C>T conversion) they could induce the translation of...Liu DR (2017) Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551:464... a mScarlet reporter, luciferase reporter, and neomycin resistance reporter. Image adapted from Katti ... -
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...optimum of 30 °C and is therefore inefficient in mammalian cells (usually grown at 37 °C). Smart molecular...identification of FLPe which has a temperature optimum of 37 °C (Buchholz, Angrand, and Stewart 1998). FLPe’s performance... receptor (ER) ligand binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These...Sadowski. 1985. “The FLP Recombinase of the Saccharomyces Cerevisiae 2 Micron Plasmid Attaches Covalently... -
Hot Plasmids and Viral Preps - March 2021
TypeBlog Post...interactions New auxin inducible degron system for C. elegans New CRISPR plasmids New items from the viral...tool-kit for the auxin inducible degron (AID) system in C. elegans By Alyssa Cecchetelli The auxin inducible... degron (AID) system has been extensively used in C. elegans since 2015 to conditionally degrade proteins...repression, and editing with a single Cas9-VPR in Saccharomyces cerevisiae. To control Cas9 activity and influence... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...10.1126/science.1231143 Elliott, B., Richardson, C., Winderbaum, J., Nickoloff, J. A., & Jasin, M. (1998....1128/mcb.18.1.93 Ran, F. A., Hsu, P. D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E....j.cell.2011.06.019 Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., & Jaenisch...j.cell.2013.04.025 Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L., & Jaenisch, R. (2013)....marker such as puromycin, you can (also) select for the positive colonies by puromycin selection. You ...transfected cells (for example, plasmid with a puromycin resistance cassette, such as PX459). After you... -
Getting the Most from Your Lentiviral Transduction
TypeBlog Post... for less than a day, lentivirus can be kept at 4°C. For long-term storage, viral preps should be divided...divided into single-use aliquots, and stored at -80°C. Some reports suggest rapidly freezing virus in a ... labs and hinders experiments is mycoplasma contamination. Mycoplasma contamination has been shown to ...routinely test for mycoplasma contamination. There are several commercially available mycoplasma detection kits...larger microbes such as yeast, fungi, or bacteria, mycoplasma can be extremely hard to detect with levels reaching...cells per ml before the media becomes cloudy. Mycoplasma compete with host cells for nutrients and can...the cell line’s growth and behavior. Signs of a mycoplasma contamination can be subtle and may include reduced... -
Your Top Requested Plasmid in 2016!
TypeBlog Post...site). Finally, in addition to the 2A peptide on its C-terminus, SpCas9 is also fused to a 3X FLAG tag at...SpCas9 is fused to the puromycin resistance gene through a 2A peptide. The puromycin resistance gene enables...causes the ribosome to translate Cas9-2A and the Puromycin resistance gene as separate peptides. PX459 This...predecessor, which had a point mutation in the puromycin resistance gene that made it less effective in... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...mEosFP’s chromophore requires a temperature below 30°C and this is not ideal for experiments in mammalian...can form it’s chromophore at a more comfortable 37°C (5). Dendra2 photoconverts from green to red fluorescence... pH stability, chromophore maturation rate at 37 °C, turnover rate, and the level of background fluorescence...: 1035-1040. PubMed PMID:18724362. 8.Stiel, Andre C., et al. "Generation of monomeric reversibly switchable...protein‐tracking studies in the budding yeast Saccharomyces cerevisiae." Yeast 25.9 (2008): 651-659. PubMed... -
Plasmids 101: E. coli Strains for Protein Expression
TypeBlog Post...conditions. Many recombinant proteins express better at 30°C or room-temperature, which is accomplished by growing...growing your culture to the desired density at 37°C and reducing the temperature or moving it to a bench-top...toxic or insoluble proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin... General protein expression m15 pREP4*, ** Kanamycin (pREP4) Cis-repression of the E. coli T5 promoter... -
Plasmids 101: Repressible Promoters
TypeBlog Post...also shown that the Q system is also functional in C. elegans. Subsequent work by the Luo and Potter labs...23995928; PMCID: PMC3811519.Seo SO, Schmidt-Dannert C. Development of a synthetic cumate-inducible gene ...; PMCID: PMC5270762. Wendler, F., Park, S., Hill, C. et al. A LexAop > UAS > QUAS trimeric plasmid to ...genes for metabolic engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197... -
Making CRISPR Plasmids Using Fragmid
TypeBlog Post...Cas proteins, guide cassettes, promoters, N’ and/or C’ terminus, and selection markers. Need fewer components...Griffith, A. L., Szegletes, Z. M., Wen, B., Kraus, C., Miller, N. W., Steger, R. J., Escude Velasco, B....Plasmid pRDB_052 (for stable fly cell lines; Hygromycin resistance gene; for genome integration by spontaneous... -
Droplet Digital PCR for AAV Quantitation
TypeBlog Post...calculate the viral titer: GC/mL = {[(R*C)(1000/V)]*D} R = Reaction volume C = Copies/uL V = Volume of virus ...Song, Neng, et al. "Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital... -
Validated gRNA Sequences
TypeCollection...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT... -
Hot Plasmids Spring 2024
TypeBlog Post...specificity of GFP expression for the indicated ssAAV5s. C) Quantifications showing high microglia transduction... microglia-targeting AAV plasmids here! Serrano, C., et al. (2023). Simple and Highly Specific Targeting... vectors for CROPseq-multi using selection by Puromycin, Zeocin®, or nuclear expression of BFP2. ... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post...arrays (e.g. for spacers A, B, and C, you could obtain arrays A, B, C, AB, AC, BC, and ABC). Nielsen Lab... ideal number. First you generate four unique kanamycin-resistant plasmids, each containing a different...construct, you clone all but one of your gRNAs into spectinomycin-resistant plasmids pX330S-2 to pX330S-(last ...monocot and dicot plants, with a choice of either hygromycin or Basta selection. Yang Lab Single Transcript...