Skip to main content

We narrowed to 67 results for: c myc vectors

Showing: 41 - 60 of 67 results
  1. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ...yeast. These tagging vectors are based on previously described pFA6a-link vectors and include a Kan, SpHIS5...from these yeast-optimized fluorophore tagging vectors for your single or multi-color imaging experiments...substitution), and tagging at either the N- or C-terminus (3xHA, 13xMyc, GST, or GFP). Longtine et al.(3) describe...
  2. Tips for arabidopsis transformation

    Type
    Blog Post
    .... (2007) ‘Improved Gateway Binary Vectors: High-Performance Vectors for Creation of Fusion Constructs ...are binary gateway vectors and can be used for promoter swapping and generating N and C terminally tagged...expression system Choosing an appropriate expression vector is the first step in generating transgenic Arabidopsis... ‘A robust family of Golden Gate Agrobacterium vectors for plant synthetic biology’, Frontiers in Plant... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...
  3. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...and improved. Takara’s “2nd generation Tet-Off vectors (Tet-Advanced)” are the most recent variants of...Recent work has even used all 3 in a single modular vector for ease of use! Conclusion This post contains ... Drosophila Terminators and PolyA Signals FLEx Vectors Resources at Addgene.org Tetracycline Collection...also shown that the Q system is also functional in C. elegans. Subsequent work by the Luo and Potter labs...23995928; PMCID: PMC3811519.Seo SO, Schmidt-Dannert C. Development of a synthetic cumate-inducible gene ...; PMCID: PMC5270762. Wendler, F., Park, S., Hill, C. et al. A LexAop > UAS > QUAS trimeric plasmid to ...genes for metabolic engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197...
  4. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting...TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning vector. The vector is 8901 base...annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning vector from step C.3 (If you were unable ...Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage....-Cloning Vector I.2 Recipes I.3 Warranty information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The ...use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent lentiviral vector chosen by the...TRC-cloning vector. Addgene Plasmid Description pLKO.1 – TRC control Negative control vector containing...
  5. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...of pExpression vectors) plasmids. The type IIS restriction sites used in these vectors are of low abundance...to produce the constructs you need. Expression vectors within this kit contain a variety of promoters ...insects, and even Xenopus oocytes. The expression vectors additionally contain various combinations of protein...Series Confronted with the problem of creating vectors for predictable protein expression in bacteria,...this so-called bicistronic design (BCD). The 49 vectors in this kit can be used to drive production of ...Dejan Gagoski used SITS to create the pCell-Free vectors, Gateway-compatible backbones that enable cell-...kit represents a set of 88 clones in a pCellFree vector that enables protein expression in any in vitro...
  6. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ...species into the pYES2.1/V5-His yeast overexpression vector. This plasmid contains origins of replication and...Resources on Addgene.org Find Yeast Expression Vectors Check Out Our Molecular Biology Reference Pages...procedure adds both V5 and His6 epitope tags to the C-termini of Met proteins, which can be used to confirm...methionine synthesis (5). The budding yeast, Saccharomyces. cerevisiae, makes a great reference organism... or not proteins from the fission yeast, Schizosaccharomyces pombe, have the same function as their counterparts...yeast for budding geneticists: A primer on the Saccharomyces cerevisiae model system. Genetics 197, 33-48...yeast for young geneticists: A primer on the Schizosaccharomyces pombe model system. Genetics 201, 402-423...
  7. Bacterial Expression Systems

    Type
    Collection
    ...peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...selection of mammalian and bacterial FRET-related vectors and standards. The Hoschschild Bacterial Two-Hybrid...FRET-based Biosensors Kit (Addgene #1000000021) is a vector library for the generation of FRET biosensors for...#1000000222) is a collection of Golden Gate compatible vectors for bimolecular fluorescence complementation experiments...reconstructed) BiFC Lynne Regan 168257 168472 pMRBad-C-wtBlc pET11a-N-DiB2 DiB2 (reconstructed) BiFC Jens...coli Cynthia Collins 112197 pANY3 Temperature (42 °C) Escherichia coli Yingfeng An Additional Addgene Controlled...Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...
  8. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ...BFP variant, a BE4am-Cas9 base editor, and sgRNA vectors for the BFP-to-GFP conversion and to target specific...expressed to identify successfully transfected cells. C-to-T editing by the APOBEC-Cas9 editosome would restore...codon that is converted to a ‘TAC’ or ‘TAT’ after a C-to-T base editing event. This edit changes the histidine... ATG codon from an ACG codon using a base-editor (C>T conversion) they could induce the translation of...Liu DR (2017) Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551:464... a mScarlet reporter, luciferase reporter, and neomycin resistance reporter. Image adapted from Katti ...
  9. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...transfection. Some lentiviral vectors deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which... gene of interest from an integrated lentiviral vector. Protocols...Lines with Lentivirus You may also like... Viral Vector Guides Virus Blog Posts Mol Bio Protocols Viral... gene of interest from an integrated lentiviral vector. Unlike the short-term protein expression observed...approaches, generating cell lines using lentiviral vectors enables long-term protein expression studies. Moreover...lentiviral transgene. Note that not all lentiviral vectors deliver antibiotic resistance. This protocol was... plasmid #52962 ) and is described in Improved vectors and genome-wide libraries for CRISPR screening....
  10. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ...Pseudomonas fluorescens, and Pseudomonas syringae. These vectors contain BsaI sites for easy cloning of a gRNA of... of cytidine and adenine base editors that enable C-to-T and A-to-G base substitutions respectively. Substitutions...:723–728 . https://doi.org/10.1021/sb500351f Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG (2018... https://doi.org/10.1016/j.cell.2013.02.022 Ronda C, Pedersen LE, Sommer MOA, Nielsen AT (2016) CRMAGE...Vridhambal GS, Rivera AJ, Montgomery SA, Fortier L-C, Barrangou R, Theriot CM, Ousterout DG (2020) In Vivo...shorter plasmid curing time. pCRISPomyces for editing in Streptomyces  Streptomyces bacteria produce a wide...created two “pCRISPomyces” systems for use in Streptomyces (Cobb et al., 2015). pCRISPomyces-1 includes ...
  11. Plasmids 101: Modular Cloning Applications and Kits

    Type
    Blog Post
    ...journal.pone.0197185. Chamness, James C., et al. “An Extensible Vector Toolkit and Parts Library for Advanced...kit has a focus on infrastructure with shuttle vectors, several delivery systems which can be engineered...engineered into the TUs, and even viral gene silencing vectors. The Plant Parts III kit has a focus on transformation...Gantner, Johannes, et al. “Peripheral Infrastructure Vectors and an Extended Set of Plant Parts for the Modular...Rapid Design and Production of Diverse Expression Vectors.” ACS Synthetic Biology, vol. 6, no. 7, American...acssynbio.7b00016. McGee, Abby V., et al. Modular Vector Assembly Enables Rapid Assessment of Emerging CRISPR...Toolkit for Extensive and Flexible Engineering of Saccharomyces Cerevisiae.” ACS Synthetic Biology, vol. 12,...
  12. Viral Production

    Type
    Collection
    ... with viral vector manufacturing facilities, such as the University of Pennsylvania Vector Core. Transfections...produced the viral vector lot. Contact us to determine which facility produced your viral vector lot. At Addgene...Empty vector particles can be identified after negative staining and appear darker than full vector particles...Electron micrograph of AAV vector preparation shows that the vast majority of the vectors consist of full particles...-80 °C. Titer Titering is either performed by Addgene or by the University of Pennsylvania Vector Core...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ... Viral Vector Packaging Service Viral Production Viral Production...
  13. Fluorescence Titering Assay

    Type
    Protocol
    ...Assay for Lentivirus You may also like... Viral Vector Guides Virus Blog Posts Mol Bio Protocols Viral...marker. Determining the titer of your lentiviral vector allows you to control the multiplicity of infection...protocol was developed using low titer lentiviral vectors (10 5 TU/mL). If you anticipate that your viral...heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots of FBS can promote...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and...
  14. Colony Formation Titering Assay

    Type
    Protocol
    ... the lentiviral vector pRosetta . The following day, cells were treated with puromycin. Colonies were ...lentiviral vector pHAGE EF1α dCas9-KRAB . The following day, cells were treated with puromycin. Colonies...Assay for Lentivirus You may also like... Viral Vector Guides Virus Blog Posts Mol Bio Protocols Viral...inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots of FBS can promote...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and...
  15. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Activity with GFP Plasmids 101: FLEx Vectors Optimizing AAV DIO and FLEx Vector Expression Plasmids 101: Knockout...split", "rapamycin", “tamoxifen”, or “light”): Cre Recombinase Plasmids ID Plasmid Description Vector Type...you can do with it, read Addgene's blog on FLEx Vectors . Flp-IN: A single FRT site within the genome of...to minimize leakiness in experiments using AAV vectors. Highlighted Plasmids Browse the tables below to...and filter the results by expression system and vector type. Find in-stock viral preps expressing Cre ...Flp Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search...and filter the results by expression system and vector type. Find in-stock viral preps expressing Flp ...
  16. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...continues to be challenging. Organism specific viral vector systems would also be beneficial for many systems...habitats - even 50 meters from Old Faithful in 60 °C soils. Dendrobatidae (Lauren O’Connell)  Poison frogs...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...
  17. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...
  18. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...Vickers, C. E., Bydder, S. F., Zhou, Y., Nielsen, L. K. (2013). Dual gene expression cassette vectors with...Botman et al., 2019 . FP Tagging Yeast tagging vectors to create fusions of proteins of interest with ...yeast codon-optimized fluorescent proteins. These vectors are based on the pFA6a-link plasmid (Sheff et al...overexpression of codon-optimized FPs in yeast. Vectors are based on the pDRF1 plasmid (Loqué et al., 2007...blue, green, and red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902. https...cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org...antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https:...
  19. Control AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Controls Viral Vector Packaging Service: Control...Constitutive 5 Edward Boyden 59133 pOTTC589 - pAAV c-fos Nuc-eYFP c-Fos EYFP Constitutive 1 Brandon Harvey 59462... eligible AAV plasmids and we’ll make the viral vector prep you need. Or fill out our form to let us know...format. Please note this does not guarantee viral vector packaging service, but lets us know what viruses... 8 Karl Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...
  20. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Lenti-luciferase-P2A-Neo Lentiviral reporter vector expressing firefly luciferase with neomycin resistance. Christopher Vakoc...NL4-3 mCherry Luciferase Lentiviral dual reporter vector expressing mCherry and firefly luciferase to simultaneously...pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro Lentiviral vector expressing destabilized EGFP. Neville Sanjana 164432...pHAGE-CMV-Luc2-IRES-ZsGreen-W Lentiviral dual reporter vector expressing firefly luciferase and ZsGreen. Alejandro...David Nemazee 161030 Zhou-pLOV-GFP-Luc Lentiviral vector expressing GFP and luciferase for use as a reporter...coronaviruses (DOCX, 184 KB) Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody Neutralization Response...production, including codon optimization, deletion of the C-terminal 18-21 amino acids and a D614G change which...
Showing: 41 - 60 of 67 results