We narrowed to 48 results for: ef1a
-
TypeBlog Post...selection. Expression is driven by a fairly strong EF1alpha promoter. We have verified expression of correctly-sized...
-
Plasmids 101: Multicistronic Vectors
TypeBlog Post...Retroviral pCMMP-MCS-IRES-Puro IRES Retroviral pEF1a-IRES-Neo IRES Mammalian MSCV-IRES-Luciferase IRES... -
Hot Plasmids - August 2020
TypeBlog Post...serotypes for the Cre-dependent Flpo recombinase pEF1a-DIO-FLPo-WPRE-hGHpA, which is now also available... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mammalian Gibson none S. pyogenes Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes...Lentiviral BsmBI yes, cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S... -
Brzezinski Lab CRISPR Collection
TypeCollection...modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter variant nuclear... -
Plan Your Experiment
TypeCollection... Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically... -
Sequencing Primers
TypeGuide...GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/... -
Plan Your Experiment
TypeGuide... Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...