...point where the temperature and humidity favors fungal growth. The ants bites down and locks their jaws...its muscles atrophy. After the ant’s death, the fungal fruiting bodies being to sprout out of the ant’...

...small subset of AAV plasmids will have technical or legal restrictions that make them ineligible for use in...submitted, the request will be reviewed by Addgene for legal approvals and technical compatibility with our production...

...commonly introduced in zebrafish through the UAS/Gal4 system for behavioral studies. In neuroscience, ...different subsets of spinal cord neurons using the Gal4/UAS system. This created fish lines with different...

... – a career in the sciences is more like an intergalactic network. Which planet will you visit? Where ...into your backpack, and step out there into the galaxy. TL;DR: Many roads need scientists open for adventure...

...as a drug-screening platform to identify new antifungals that target calcineurin. Current calcineurin ...calcineurin gene reporters are based on the bacterial βgal assay, and are not suited to high throughput screening...

...Addgenie in the company. Our Finance, Business and Legal teams had to pave the way for this project with ...out what we can afford to do and when. Addgene’s Legal Team acquired permission from relevant plasmid depositors...

...museum "Fábrica Centro Ciência Viva" in Aveiro, Portugal. If cancer was a musician, then metastasize is...museum "Fábrica Centro Ciência Viva" in Aveiro, Portugal. She is particularly interested in science journalism...

...collaboration and innovation between legal and scientific fields.” Thanks to our legal team, and great customer service...

...need to track the location, quality, growth, and legal status of thousands of plasmids a day, like we do... all of Addgene - within the office, within our legal department, and, of course, within the lab. In order...

...Faculty of Sciences of NOVA University in Lisbon, Portugal. She leads the Glycoimmunology group based at ... the Glycoimmunology group at UCIBIO, FCT-UNL, Portugal. Her main work focuses on unraveling the pathophysiological...

...interact with DNA independently of dCas9 targeting (Galonska 2018). This means that off-target loci – in neighboring... 301, 89–92. https://doi.org/10.1038/301089a0. Galonska C, Charlton J, Mattei AL et al (2018). Genome-...

...Although the original Y2H systems utilized the yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter...Martinez-Arias A., Shapira S.K., Chou J. Beta-galactosidase gene fusions for analyzing gene expression in...

...fruit fly is the array of genetic tools, such as the GAL4/UAS and LexA system, that allows scientists to easily...systems but can be quite difficult and time consuming. GAL4/UAS was first described in 1993 by Norbert Perrimon...

...26355004 Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes...

...ODG1 GAL galanin prepropeptide GALN, GLNN, GMAP, MGC40167 GALP galanin-like peptide - GALR2 galanin receptor...receptor 2 GALNR2, MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1, ...PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME1 proteasome (prosome, macropain) activator...PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME2 proteasome (prosome, macropain) activator...interferon gamma transducer 1) AF-1, IFGR2, IFNGT1 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte...

...promoter. cGAL and Split cGAL plasmids - Paul Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system...

...facilitation for the transfer plasmid, including legal approval and an implementation letter DNA amplification...applicable transfer plasmid. We will help you gain legal usage of the transfer plasmid from the providing...materials, using them in the lab, and even managing legal permissions and distribution. Troubleshooting If...

...-BB contains the GAL1 promoter, placing TALORs built into this vector under galactose-inducible expression...Bogdanove/Voytas) in order to generate TALORs (TAL Orthongal Repressors) that can be used to custom repress...

...Additional Resources on the Addgene Blog Are you a Frugal Scientist? Save Money with the Baby Gel Box Find...

...request is received, we’ll review for technical and legal compliance, and then send you an email with a link...