Skip to main content
Addgene
Showing: 581 - 600 of 641 results

  1. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ... PPE protocols . Working in a BSL-2 laboratory requires laboratory glasses in addition to coat and gloves... eat, drink, chew gum, or apply makeup in the laboratory. Before you start your experiment, make sure ...Only mechanical pipetting should be done in the laboratory. Don’t mouth pipette! There may be some times...officer. BSL-2 Guidelines Remember, the BSL-1 laboratory guidelines above are expected to be followed ...not be worn outside of the BSL-2 area. BSL-2 laboratories must be clearly marked as “BSL-2.” The names...names and contact information of the laboratory manager should be clearly visible in the room and on the ...vaccination or titer prior to starting work in the laboratory. For some biohazardous waste, an autoclave or...

  2. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC ...forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG...

  3. CRISPR Guide

    Type
    Guide
    ...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified...

  10. Antibodies 101: Validation

    Type
    Blog Post
    ...may not be the most accessible option for many laboratories. Additionally, it can be difficult to distinguish...

  13. AAV Production in HEK293 Cells

    Type
    Protocol
    ...before putting the CS5 in the incubator. Return the CS5 to the incubator for 96 h. This incubation time...Hemocytometer or cell counter Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH ...pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents Adherent HEK293T cells (...media and mix. Seed all cells in 1 CS2. Return to incubator for 48 h. Trypsinize and resuspend cells from ... with a total volume of 850 mL. Return to the incubator for 24 h–36 h. Proceed with transfection: Calculate...2% HI-FBS. Mix well. Take the CS5 out of the incubator and pour the media into a waste container. Carefully...evenly between the layers. Return the CS5 to the incubator for ~72 h. Harvest cells and media by tapping ...

  14. Optogenetics Guide

    Type
    Guide
    ...signals; e.g., calcium indicators In this overview, we will focus on the common actuators used in optogenetics...classified based on their functions into two groups: Actuators are genetically-encoded tools for light-activated...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ...experiment? Depending on your answer, you’d pick an excitatory or inhibitory opsin, respectively. Color of activation...domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation. Utilizes...plasmids rely on the engineered two-component regulatory system YF1/FixJ. YF1 is a synthetic, photosensitive...chromophore, and phosphorylates the transcriptional activator FixJ in the absence of blue light. 470 Fluorescent...

  15. Typing CRISPR Systems

    Type
    Blog Post
    ...Samai, P., Pyenson, N., Jiang, W., Goldberg, G. W., Hatoum-Aslan, A., & Marraffini, L. A. (2015). Co-transcriptional...

  19. Chemogenetics Guide

    Type
    Guide
    ... Experiment References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ...of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered...Depending on your answer, you’d pick a chemogenetic activator or inhibitor, respectively. DREADDs or PSAMs or...delivery. Chemogenetic ligand. The chemogenetic actuator chosen and the context of the experiment will ...such as DCZ versus CNO. Delivery. Chemogenetic actuators are delivered in vivo through viral injection ...Selective Modulation of cAMP Production in Striatopallidal Neurons. Neuropsychopharmacol. 38:854–862. ...Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and behavioral modulations...
Showing: 581 - 600 of 641 results