Skip to main content

We narrowed to 14 results for: ATO

Showing: 1 - 14 of 14 results
  1. Promoters

    Type
    Guide
    ...by various DNA regulatory sequences, including enhancers, boundary elements, insulators, and silencers... RNA polymerase), an operator (a segment of DNA in which a repressor or activator can bind), and the structural...genes that are controlled by a single promoter and operator. Operons are common in prokayotes, specifically...its conformation, preventing its binding to the operator and thus allowing for transcription. The Lac operon...transcribed until a repressor/corepressor binds to the operator preventing transcription. The trp operon involved... sequences. It is not unusual to have several regulatory elements, such as enhancers, several kilobases...factors, and other accessory proteins (such as activators and structural proteins) make up the transcription...
  2. Sequencing Primers

    Type
    Guide
    ...CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA...GCTAGTTATTGCTCAGCGG T7 terminator Reverse Tac promoter GAGCGGATAACAATTTCACACAGG Tac promoter Forward tdTomato-Fwd CTGTTCCTGTACGGCATGG...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator Reverse Other Common Sequencing Primers Name ...GCAAATGGCATTCTGACATCC For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit...Reverse EBV Reverse GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...
  3. CRISPR Guide

    Type
    Guide
    ...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators — co-expression of dCas9-VP64 with a modified...
  4. Modular Cloning Guide

    Type
    Guide
    ...basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked by fusion sites into individual... signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules...Daniel Voytas 93 additional plasmids including regulatory elements, coding sequences, CRISPR parts GreenGate... vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular Cloning (JMC) Toolkit...expression, RBS strength variants, synthetic terminators, protein purification tags and fluorescence proteins...tag-compatible RBSs, 2 secretion tags, 6 CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones,...protocols for rapid one-pot, multipart assembly, combinatorial design and expression tuning in E. coli . CIDAR...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors...single strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal...are necessary for lentiviral production in the laboratory, and many have been removed or mutated for increased...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific... genome. To produce lentiviral vectors in the laboratory, the non-required components have been removed... — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids...plasmid — contains entire viral genome (packaging, regulatory, and accessory genes), only envelope removed ...
  6. Chemogenetics Guide

    Type
    Guide
    ... Experiment References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ...of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered...Depending on your answer, you'd pick a chemogenetic activator or inhibitor, respectively. DREADDs or PSAMs or...delivery. Chemogenetic Ligand The chemogenetic actuator chosen and the context of the experiment will ...such as DCZ versus CNO. Delivery Chemogenetic actuators are delivered in vivo through viral injection ...Selective Modulation of cAMP Production in Striatopallidal Neurons. Neuropsychopharmacol, 38 (5), 854–...Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and behavioral modulations...
  7. Guide to Using Pooled Libraries

    Type
    Guide
    ...enzyme fused to a transcriptional activator to target genes or regulatory regions, where it stimulates transcription...high-throughput experiments, including studying regulatory sequences, screening certain types of proteins...transcription by recruiting activators or modifying local chromatin. Inhibition : CRISPR inhibition libraries...genomic libraries, but they do not contain as much regulatory information. To make a cDNA library, cDNA is ...Limitations Non-physiological expression Cannot capture regulatory/isoform complexity shRNA/RNAi shRNA libraries...
  8. Optogenetics Guide

    Type
    Guide
    ...nm) bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation, based on... upon illumination 450 miniSOG Singlet oxygen generator; can be used to disrupt cellular function or ablate...LOV domain) phosphorylates the transcriptional activator FixJ, driving gene expression 470 TULIP Tunable...experiment? Depending on your answer, you'd pick an excitatory or inhibitory opsin, respectively. For experiments..., B., Melkonian, M., Jayaraman, V., Constantine-Paton, M., Wong, G. K., Boyden, E. S. (2014). Independent...
  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...gamma-retroviral vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors...increased safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus... Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S., Su, L.,...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes...
  10. Plan Your Experiment

    Type
    Guide
    ...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...requires dCas9 to be fused to transcriptional activators that need to be within a given range of the transcription...
  11. Adenovirus Guide

    Type
    Guide
    ...diseases in humans and other animals, most commonly respiratory infections, such as the common cold. The immune... express them alongside a guide RNA and other regulatory elements. The packaging capacity of rAdV vectors...such as expressing cytokines and other immune-modulatory molecules. Another strategy has been to use oncolytic...
  12. Molecular Biology Reference

    Type
    Guide
    ...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term... contain a promoter sequence, a transcription terminator sequence, and the inserted gene. An expression... and the sequence outputted in the form of a chromatogram. Sanger can sequence approximately 500–1,000...
  13. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... factories for the new viral particles in the laboratory. The cell line used for rAAV vector production...packaging capacity, especially if any additional regulatory elements are needed. One strategy to overcome...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes...
  14. Educational Resources

    Type
    Guide
    ... a wide range of topics in molecular biology, laboratory research, and career development. eBooks Download...
Showing: 1 - 14 of 14 results