Skip to main content
Addgene

We narrowed to 13 results for: ATO

Showing: 1 - 13 of 13 results
  1. Promoters

    Type
    Guide
    ...by various DNA regulatory sequences including enhancers, boundary elements, insulators, and silencers....the RNA polymerase, an operator, a segment of DNA in which a repressor or activator can bind, and the structural...proximal promoter which contains many primary regulatory elements. The proximal promoter is found approximately...transcription factor binding sites, but mostly contains regulatory elements. Eukaryotic Promoters Eukaryotic Transcription... sequences. It is not unusual to have several regulatory elements such as enhancers several kilobases ...genes that are controlled by a single promoter and operator. Operons are common in prokayotes, specifically...its conformation, preventing its binding to the operator and thus allowing for transcription. The Lac operon...
  2. CRISPR Guide

    Type
    Guide
    ...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified...
  3. Modular Cloning Guide

    Type
    Guide
    ...basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked by fusion sites into individual... signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules...Daniel Voytas 93 additional plasmids including regulatory elements, coding sequences, CRISPR parts GreenGate... vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular Cloning (JMC) Toolkit...expression, RBS strength variants, synthetic terminators, protein purification tags and fluorescence proteins...tag-compatible RBSs, 2 secretion tags, 6 CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones,...protocols for rapid one-pot, multipart assembly, combinatorial design and expression tuning in E. coli . CIDAR...
  4. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC ...forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors...single strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal...are necessary for lentiviral production in the laboratory, and many have been removed or mutated for increased...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific... genome. To produce lentiviral vectors in the laboratory, the non-required components have been removed... — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids...plasmid — contains entire viral genome (packaging, regulatory, and accessory genes), only envelope removed ...
  6. Optogenetics Guide

    Type
    Guide
    ...signals; e.g., calcium indicators In this overview, we will focus on the common actuators used in optogenetics...classified based on their functions into two groups: Actuators are genetically-encoded tools for light-activated...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ...experiment? Depending on your answer, you’d pick an excitatory or inhibitory opsin, respectively. Color of activation...domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation. Utilizes...plasmids rely on the engineered two-component regulatory system YF1/FixJ. YF1 is a synthetic, photosensitive...chromophore, and phosphorylates the transcriptional activator FixJ in the absence of blue light. 470 Fluorescent...
  7. Chemogenetics Guide

    Type
    Guide
    ... Experiment References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ...of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered...Depending on your answer, you’d pick a chemogenetic activator or inhibitor, respectively. DREADDs or PSAMs or...delivery. Chemogenetic ligand. The chemogenetic actuator chosen and the context of the experiment will ...such as DCZ versus CNO. Delivery. Chemogenetic actuators are delivered in vivo through viral injection ...Selective Modulation of cAMP Production in Striatopallidal Neurons. Neuropsychopharmacol. 38:854–862. ...Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and behavioral modulations...
  8. Molecular Biology Reference

    Type
    Guide
    ...can be replicated easily and efficiently in a laboratory setting. Stable - Plasmids are stable long-term... contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter...RNA from the insert DNA via transcription. The terminator sequence on the newly synthesized RNA signals...design a effective primer. Sanger sequencing chromatogram Sanger sequencing is modeled after in vitro ...sequencing results are presented as a sequencing chromatogram which provides the color and intensity of each...
  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...gamma-retroviral vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors...increased safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus... Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S., Su, L.,...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes...
  10. Plan Your Experiment

    Type
    Guide
    ...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...requires dCas9 to be fused to transcriptional activators that need to be within a given range of the transcription...
  11. Adenovirus Guide

    Type
    Guide
    ...diseases in humans and other animals, most commonly respiratory infections, such as the common cold. The immune... express them alongside a guide RNA and other regulatory elements. The packaging capacity of rAdV vectors...such as expressing cytokines and other immune-modulatory molecules. Another strategy has been to use oncolytic...
  12. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... factories for the new viral particles in the laboratory. The cell line used for rAAV vector production...packaging capacity, especially if any additional regulatory elements are needed. One strategy to overcome...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes...
  13. Educational Resources

    Type
    Guide
    ... a wide range of topics in molecular biology, laboratory research, and career development. eBooks Download...
Showing: 1 - 13 of 13 results