We narrowed to 660 results for: EPO
-
TypeCollection... also lists several luciferase and fluorescent reporter plasmids that have been used for measuring viral...acids SARS-CoV-2 main protease (Mpro) activity reporters Reverse transcriptase, protease, and polymerase... Heurich, A., Hofmann-Winkler, H., Gierer, S., Liepold, T., Jahn, O., & Pöhlmann, S. (2014). TMPRSS2 and...
-
Lentivirus Plasmids
TypeCollection...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Parijs...Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression Kissler...transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452... -
CRISPR 101: Cytosine and Adenine Base Editors
TypeBlog Post...editing for plants Read about four base editor reporters Additional Resources on Addgene.org Catch up... -
Validated gRNA Sequences
TypeCollection...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...possible on the sequences, and email the file to deposit@addgene.org with the subject heading "gRNA sequence... -
Zinc Finger Consortium Reagents
TypeCollection...engineering and expressing zinc finger proteins deposited by Zinc Finger Consortium members like the Joung...Consortium members Keith Joung and Daniel Voytas have deposited at Addgene various reagents for engineering and... -
Fluorescent Protein Guide
TypeCollection...the plasmids that are available from Addgene's depositing scientists....Proteins: Plasmids and Resources Addgene's plasmid repository contains thousands of fluorescent proteins. Use... -
Troubleshooting and Optimizing a Western Blot
TypeBlog Post...blot, you may want to consider using a different reporter or, if you don’t need to compare the protein amounts... -
E11 Bio PRISM Collection
TypeCollection... Depositor Collections E11 Bio PRISM Collection E11 Bio PRISM...packaged together in one AAV preparation. The depositing lab recommends keeping these production runs ... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...New England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids... Depositor Collections New England Biolabs Cell-Imaging Plasmid... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...Endogenous Zebrafish Gene Targets Recent published reports have shown that engineered zinc finger nucleases...greater in a well-characterized bacterial two-hybrid reporter system but have NOT yet been tested for activity... -
Plant Plasmids and Resources
TypeCollection...Proteins Other Resources Background Addgene’s repository contains many plasmid tools that were specifically...tools). Support open science in plant biology - deposit plant plasmids with Addgene! CRISPR Please refer... -
Viral Production
TypeCollection...expression and/or function. These data are sometimes reported or posted on the material page for the corresponding...recipient's initial thaw will be accounted for in our reported titers. Lentiviral vectors are titered using a... -
Fluorescent Proteins: FRET
TypeCollection...single-nanometer scale, scientists can use FRET to report on protein binding or conformational changes. Organic...your experiment, be sure to refer to published reports and include appropriate controls to help interpret... -
Neurodegeneration Research Collection
TypeCollection... S A. 2023 Aug 22. Use a lentiviral FRET-based reporter to study tau seeding in mammalian cells. Lathuiliere... (AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell... -
The Pleiades Promoter Project
TypeCollection... Depositor Collections Pleiades Promoter Plasmids Pleiades...MiniPromoters MiniPromoter Source Gene Construct Reporter Ple2 ADORA2A pEMS1142 EGFP/NLS Ple3 ADORA2A pEMS1143... -
Caltech Systemic Capsids
TypeCollection...Addgene’s Data Hub and the Caltech CLOVER Center’s repository of published capsid use (Link opens in a new ...tropism exhibited by the PHP.eB serotype has been reported to occur by using the cellular receptor LY6A (... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection... Depositor Collections Allen Institute for Brain Science ...expression from mouse to primate neocortex. Cell Reports , 34 (13), 108754. https://doi.org/10.1016/j.celrep... -
Plan Your Experiment
TypeCollection...in question (see CRISPR protocols from Addgene depositors ). Browse empty gRNA expression vectors . Select...facilitates CRISPR/Cas9-based genome editing. Scientific Reports , 5 , 11315. https://doi.org/10.1038/srep11315 ... -
Synthetic Biology - Browse Plasmids
TypeCollection...link to view all plasmids available from this depositor's lab. Plasmid Description Gene/Insert Vector Type... -
Synthetic Biology - Algal
TypeCollection...link to view all plasmids available from this depositor's lab. Plasmid Description Gene/Insert Vector Type...