We narrowed to 771 results for: LIS;

1. Viral Vectors 101: Gamma-Retroviral Packaging Systems

   Type

   Blog Post

   ...updated by multiple Addgenies. It was originally published in 2018, in the Viral Vectors 101 eBook, 1st edition...

2. Viral Vectors 101: Viral Vector Elements

   Type

   Blog Post

   ... other relevant viral genes (including the ones listed previously). E3/E1B suppresses both apoptosis and...

3. Viral Vectors 101: Viral Applications

   Type

   Blog Post

   ...Versatile Viral tool for Gene Expression in Mammals Listen to Connie Cepko Discuss Gene Therapy with AAV ...

4. A Deep Dive into BioBuilder

   Type

   Blog Post

   .... (and Mexico in 2018). BioBuilder textbook, published by O’Reilly Media. BioBuilder's open-access curriculum...

5. Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies

   Type

   Blog Post

   ...chromosome your transgene has integrated. This can be accomplished with a few matings to balancer chromosome lines...

6. A Practical Approach to Choosing the B(right)est Fluorescent Protein

   Type

   Blog Post

   ...precise determination of brightness in cells, under realistic experimental conditions. By determining the brightness...

7. Addgene’s Viral Service - Why Virus? Why Now?

   Type

   Blog Post

   ...Wyss Institute were instrumental in helping us establish consistent, high-quality protocols for lentiviral...

8. Plasmids 101: Methylation and Restriction Enzymes

   Type

   Blog Post

   ...methylation site. The quick-reference table below lists 10 common enzymes that may be affected by methylation...

9. How to Keep a Lab Notebook for Bioinformatic Analyses

   Type

   Blog Post

   ...Find Protocols for Your Next Experiment Find Our List of CRISPR gRNA Design Tools ...

10. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type

    Blog Post

    ...attention on transcription factors, starting with an established method called ChIP-seq. ChIP-seq relies on antibodies...

11. Plasmids 101: Blue-white Screening

    Type

    Blog Post

    ...Cloning Technique for You Browse Addgene's curated list of Bacterial Expression Systems Find Empty Backbones...

12. Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs

    Type

    Blog Post

    ...Hijacking tRNA processing to make gRNAs In a recently published paper, Yinong Yang’s group did just that as part...

13. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type

    Blog Post

    ... now. Enter the SAM pooled library In a paper published in Nature in December, Konermann and her colleagues...

14. 3 Challenges in Plant Synthetic Biology

    Type

    Blog Post

    ...biochemical pathways involved in central anthocyanin metabolism are well understood. Additional work has also...

15. Advice for Starting a Biotech Company from a Grad Student turned Entrepreneur

    Type

    Blog Post

    ...visionary, a science-minded individual, and a specialist. Notably, the team must have an upfront conversation...

16. Will You Be My Mentor? Finding and Asking for Mentoring Support

    Type

    Blog Post

    ...have good ideas for who you should connect with. Listen to our podcast interview with Harvard Medical School...

17. Kiran Musunuru on the Newest TALEN Genome-Editing System

    Type

    Blog Post

    ...to examine the effect of a gene on cholesterol metabolism. The TALEN kit is quite useful in generating ...

18. Ras Pathway

    Type

    Collection

    ...Pathway Background Ras Pathway Plasmids Ras Gene List Resources Background Ras is a small GTPase and is...available plasmids for the gene, or browse the gene list below. For proteins with multiple subunits or isoforms...Cancer Research Return to top Ras Pathway - Gene List Click on a name to find available plasmids for the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...

19. Validated gRNA Sequences

    Type

    Collection

    ... Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have been experimentally validated...experiment as described in the associated article (listed below by PubMed ID). These factors include: Does...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...

20. What's New in CRISPR - November 2021

    Type

    Blog Post

    ... question. Three different labs have recently published work that provides a solution to this problem....