We narrowed to 14 results for: LIS;
-
TypeGuide...17360345 (Link opens in a new window) Berglund K, Clissold K, Li HE, Wen L, Park SY, Gleixner J, Klein ME, Lu...29351511 (Link opens in a new window) Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL (2007). Evolving...) Guettier JM, Gautam D, Scarselli M, de Azua IR, Li JH, et al. (2009). A chemical-genetic approach to...Link opens in a new window) Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al. (2015). A New DREADD...experiments in this species may be entirely due to back-metabolism of CNO to clozapine, demonstrating the need for...activity, and do not seem to have the same back-metabolism issues as CNO and are attractive alternatives...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor...
-
CRISPR Guide
TypeGuide...Bartolomei, M. S., Ferguson-Smith, A., Li, D., Yang, L., Wu, Y., & Li, J. (2015). CRISPR-Cas9-Mediated Genetic...: 25494202 Liu, X., Zhang, Y., Chen, Y., Li, M., Zhou, F., Li, K., Cao, H., Ni, M., Liu, Y., Gu, Z., Dickerson...: 23287718 Cui, Z., Tian, R., Huang, Z., Jin, Z., Li, L., Liu, J., Huang, Z., Xie, H., Liu, D., Mo, H...., J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T....V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li, Z., Peterson, R. T., Yeh, J. J., Aryee, M. J., &...29160308 Hess, G. T., Frésard, L., Han, K., Lee, C. H., Li, A., Cimprich, K. A., Montgomery, S. B., & Bassik...., Levesque, S., Jing, Y., Simpson, D., Zhao, A., Li, H., Yan, W., Goudy, L., Schmidt, R., Solley, S. ... -
Adeno-associated virus (AAV) Guide
TypeGuide...Link opens in a new window) Liu, D., Li, T., Liu, L., Che, X., Li, X., Liu, C., & Wu, G. (2024). Adeno-associated...AAVs cannot enter the lytic cycle, and instead establish latent infections by integrating into the host... -
Gamma-Retroviral Vector Guide
TypeGuide...doi.org/10.1073/pnas.94.16.8640 PMID: 9238030 Wu, X., Li, Y., Crise, B., & Burgess, S. M. (2003). Transcription...vectors, they offer the benefit of having well-established protocols for fast and efficient generation of...large-scale, high-titer preps. This is thanks to established retroviral production cell lines that are able... -
Adenovirus Guide
TypeGuide...., Zhao, C., Zheng, Z., Shu, Y., Wu, X., Lei, J., Li, Y., Zhang, W., Yang, C., Wu, K., Wu, Y., Ho, S.,...remain the most popular choice due to their well-established methods, relative simplicity of production, and... -
Antibody Guide
TypeGuide...two most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein ...expression and assay efficacy. ELISA Enzyme-linked immunosorbent assay (ELISA) is a plate-based assay that...differentiate between proteins. HRP is also used in ELISAs, which only measure a single antibody signal. Here...relative amounts of protein. Includes: Western blot ELISA Capture - used to isolate specific proteins or protein...Quantification methods, such as western blots or ELISAs, are used to quantify relative amounts of protein...standard curves to quantify exact amounts of proteins. ELISAs quantify a single protein per assay and typically...signaling molecule. Figure 4: A direct sandwich ELISA, which uses a capture antibody and a primary conjugated... -
Sequencing Primers
TypeGuide...deposited plasmids. Below is a list of commonly used primers. This list is available for your convenience...A list of sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...Primers Looking for Primers? The primer sequences listed on the left are provided for your reference. Addgene...find your plasmid page and see what primers are listed under "5' sequencing primer" and "3' sequencing...Addgene's Molecular Biology Reference Page . All listed primers are 5′ to 3′. Commonly Used Primers CMV...TAATACGACTCACTATAGGG T7 promoter, forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia... -
Molecular Biology Reference
TypeGuide...used primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...expression of an endogenous gene. This is frequently accomplished through expression of an shRNA targeting the...edit genomes. Genome editing is most commonly accomplished using CRISPR technology. CRISPR is composed ...-related information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New ...resistance genes as well as additional antibiotics not listed in the table below can be found in this blog post...Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK ... -
Optogenetics Guide
TypeGuide...relevant variants. This list is not exhaustive - please browse our curated list of opsins here to find ...depression, drug addiction, and more. Below is a list of commonly used microbial opsins, including a brief...Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale, genetically targeted optical control... -
Guide to Using Pooled Libraries
TypeGuide...relevant to the phenotype being studied. Examples of published selection mechanisms for lentiviral CRISPR libraries...cells Sequence those cells that pass (“win”) Get a list of genes involved in the selection NEGATIVE screen...between experimental and control cells Generate a list of gRNAs that disappear with addition of the selection... -
Educational Resources
TypeGuide...using Addgene’s materials, and career advice. Playlists include: Protocols Careers How-to Blog Read about... -
Cloning
TypeGuide...still be fused together in a seamless manner. To accomplish this, you just need to introduce into the yeast... -
Plan Your Experiment
TypeGuide...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial... -
Lentiviral Vector Guide
TypeGuide...PMID: 36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini...